Содержание

Хронические заболевания печени у мелких животных

Введение

Печень – важный орган, ответственный за расщепление питательных веществ и синтез многих молекул, таких как альбумин, факторы свертывания крови, холестерин, глюкоза и многие другие. Печень обладает феноменальной способностью к регенерации. Например, у людей половину печени можно пересадить от живого донора реципиенту, и через 6 недель как пересаженная печень, так и остаток печени донора достигнут нормального объема. Несмотря на способность печени к регенерации, заболевания печени могут привести к смерти, так как организм не может жить без печени, а экзогенная поддержка функции печени у собак и кошек в настоящее время невозможна, даже в течение короткого периода времени. Заболевания печени часто встречаются у собак и кошек. Острое поражение печени может быть вызвано инфекционными болезнями или интоксикациями. Хронические заболевания печени встречаются чаще, чем острые поражения. Наиболее распространенными хроническими заболеваниями печени являются хронический гепатит или холангит, гепатопатии, ассоциированные с накоплением меди, ятрогенные заболевания печени и сосудистые поражения печени, которые, за исключением сосудистых поражений печени, будут более подробно рассмотрены ниже. 

Хронический гепатит и холангит

Хронический гепатит – это гетерогенная группа хронических заболеваний печени у собак, которая ассоциирована с воспалительной инфильтрацией печени. Сходным образом, холангит – это гетерогенная группа заболеваний печени и желчных протоков у кошек, которые также приводят к воспалительной инфильтрации печени и желчных протоков. Существует много различных этиологий хронического гепатита/холангита, включая инфекции (например, инфекционный гепатит собак или лептоспироз), влияние лекарств (например, противосудорожных препаратов), наследственную предрасположенность (например, у доберман-пинчеров, бедлингтон-терьеров, кокер-спаниелей, вестхайдлендских белых терьеров и др.). Однако большинство случаев хронического гепатита/холангита являются идиопатическими. 

Клиническая картина

Клинические признаки у собак и кошек с хроническим гепатитом/холангитом часто являются неспецифическими. Наиболее частыми являются сонливость, анорексия, снижение массы тела и рвота. У кошек с холангитом также могут обнаруживаться повышенная температура тела и боли в животе. При недостаточности функции печени возможны и другие признаки, такие как диарея, полидипсия, полиурия, желтуха, асцит и геморрагический диатез. 

Наиболее частым результатом обследования у собак и кошек с хроническим гепатитом/холангитом является повышение уровней ферментов печени, таких как аланин-аминотрасфераза (ALT) и сывороточная щелочная фосфатаза (SAP). В более тяжелых случаях могут также наблюдаться гипоальбуминемия, гипербилирубинемия, гипохолестеринемия и снижение уровня азота мочевины крови (BUN). Примерно у половины всех кошек с холангитом имеется гиперглобулинемия, но она не является частым признаком у собак с хроническим гепатитом.

Концентрации желчных кислот  натощак и после еды могут быть повышенными в зависимости от тяжести патологического процесса.

У пациентов с печеночной недостаточностью параметры свертывания крови могут быть аномальными, либо из-за нарушения синтеза факторов свертывания крови, либо из-за диссеминированной внутрисосудистой коагуляции. 

Рентгеновские снимки брюшной полости обычно в пределах нормы. Однако у пациентов с последней стадией цирроза печень может выглядеть уменьшенной. 

Ультразвуковое исследование органов брюшной полости часто выявляет изменения

эхогенности печени и неровные края печени. В более тяжелых случаях могут визуализироваться асцит и приобретенные внутрипеченочные шунты. 

Диагностика

Диагностика хронического гепатита/холангита основана на гистопатологии. Цитологической оценки тонкоигольного аспирата недостаточно для постановки диагноза хронического гепатита/холангита. Биоптаты для гистопатологической оценки можно получить посредством биопсии режущей иглой, лапароскопии или диагностической лапаротомии.

Биопсия режущей иглой менее инвазивна, но пригодна лишь для получения небольших биоптатов. В противоположность этому, лапароскопия обеспечивает получение образцов значительно большего размера, а также возможность визуальной инспекции поверхности печени и прямого выявления кровотечения.

В одном из исследований было высказано мнение, что биопсия при лапароскопии превосходит биопсию режущей иглой. Однако для того, чтобы сделать окончательную оценку, необходимо большее число исследований.

Независимо от способа, которым выполнена биопсия, один из биоптатов следует обязательно направить на бактериологическое культивирование. 

Лечение

Лечение хронического гепатита/холангита может быть направлено на основную причину заболевания, то есть на воспаление печени, или может быть поддерживающим или симптоматическим по своей природе у пациентов с печеночной недостаточностью. 

Терапевтические меры, направленные на основную причину, могут представлять собой антибиотикотерапию у собак с лептоспирозом или у кошек с гнойным холангитом. В других случаях они могут представлять собой изменение противосудорожного  препарата у собак с хроническим гепатитом, обусловленным противосудорожным лечением. У пациентов, у которых исключена инфекционная этиология, может быть начата противовоспалительная терапия.

Не существует контролированных исследований, в которых оценивалась бы польза от терапии кортикостероидами для собак с хроническим гепатитом. Однако большое ретроспективное исследование выявило полезный эффект от лечения кортикостероидами у собак с хроническим гепатитом. Автор предпочитает использовать кортикостероиды в тех случаях, когда бактериальная культура из биоптата печени отрицательна и пациент не реагирует на попытки эмпирического лечения антибиотиками. Если используются кортикостероиды, то начать лечение пациента следует с высокой дозы преднизона или преднизолона, равной 2 мг/кг два раза в день в течение 5 дней, затем 1 мг/кг два раза в день в течение 6 недель, после чего дозу следует медленно свести на нет. Если побочные эффекты кортикостероидов становятся очень сильными, можно рассмотреть возможность использования других противовоспалительных агентов, таких как азатиоприн.

За пациентами, получающими лечение противовоспалительными средствами, следует внимательно наблюдать, поскольку некоторые пациенты могут не получить пользы от кортикостероидов, и их состояние может даже ухудшиться. 

Поддерживающая терапия может включать в себя применение урсодезоксихолевой кислоты, S–аденозил–L–метионина (SAME) или других антиоксидантов. Хотя  контролированных исследований, выполненных на собаках и кошках, нет, испытания на людях показали полезный эффект урсодезоксихолевой кислоты у пациентов с хроническим гепатитом. Недавно было предложено использовать антиоксидант S–аденозил–L–метионин (SAME) для вспомогательной терапии у собак и кошек с хроническим гепатитом/холангитом. Начальные исследования показали, что SAME пополняет запас глутатиона, однако данных, полученных на пациентах в клиниках, еще недостаточно. Некоторыми авторами предлагались другие агенты, например – витамин Е, силимарин или экстракт расторопши пятнистой, но имеется мало данных относительно их эффективности. Считается, что некоторые агенты обладают антифибротическими свойствами, в том числе колхицин, преднизолон, азатиоприн и другие. К сожалению, не продемонстрирована эффективность ни одного из этих агентов у собак и кошек с хроническим гепатитом/холангитом. 

Пациентов с печеночной недостаточностью следует кормить кормами с низким содержанием белка. Кроме того, для лечения гепатической энцефалопатии можно использовать оральное введение лактулозы и неомицина.

Гепатопатии, ассоциированные с накоплением меди

Медный токсикоз (CT) характеризуется чрезмерным накоплением меди в гепатоцитах и представляет собой наследственное заболевание печени, которое встречается главным образом у бедлингтон-терьеров, а также у вестхайлендских белых терьеров, скай-терьеров, доберман-пинчеров, а недавно было обнаружено у лабрадоров-ретриверов. Сходное заболевание очень редко встречается у сиамских кошек. 

Наследственные предпосылки 

Показано, что у бедлингтон-терьеров медный токсикоз наследуется по аутосомно-рецессивному типу. Исследования сцеплений выявили сцепление медного токсикоза с маркером СО4107. В настоящее время имеется генетический тест на медный токсикоз для бедлингтон-терьеров (www.vetgen.com). Этот тест можно использовать для выявления собак, предрасположенных к этому заболеванию, которые получат пользу от лечения, препятствующего накоплению меди, с целью предотвращения развития клинической картины заболевания. Тест также является научным инструментом, который поможет заводчикам собак разработать стратегию разведения.

Патофизиология 

Медный токсикоз у бедлингтон-терьеров сходен с болезнью Вильсона у людей. Медь в норме хранится в гепатоцитах. У собак с медным токсикозом содержание меди в печени увеличивается до тех пор, пока не будет превышен критический пороговый уровень. Возникает повреждение тканей, степень которого зависит от содержания меди в печени и варьирует от острого некроза печени до цирроза печени. Собаки с медным токсикозом могут также переносить тяжелый гемолитический криз после стрессовых событий, таких как роды. Избыток меди, накопившийся в печени, может быть выделен в кровоток, что приводит к гемолитической анемии, острой почечной недостаточности и диссеминированному внутрисосудистому свертыванию крови (DIC).

Клинические признаки

Частыми клиническими признаками являются анорексия, рвота и диарея. У хронически больных собак могут также развиться желтуха, асцит и гепатическая энцефалопатия. У любой собаки с медным токсикозом может развиться связанный со стрессом острый гемолитический криз.

Диагностика

Для диагностики необходимо исследование биоптатов печени, окрашенных специальным красителем для выявления меди. Измерение концентрации меди в печени предпочтительно, и содержание меди, превышающее 850 мкг/г сухой массы, считается признаком нарушения накопления меди.

Лечение

У собак с медным токсикозом нарушены хранение и выделение меди. Поэтому основной терапевтический подход состоит в том, чтобы предотвратить избыточное накопление меди. Для обеспечения низкого потребления меди необходимо исключить из рациона такие источники белка, как ракообразные, печень, почки и сердце. Многие коммерческие корма для животных также имеют высокое содержание меди, и поэтому следует тщательно исследовать корма, прежде чем кормить ими животное в течение длительного времени.

Цинк обладает способностью блокировать всасывание меди в кишечнике, и поэтому его можно использовать в качестве пищевой добавки (100 мг цинка перорально два раза в день в течение 3 месяцев, затем по 50 мг перорально два раза в день) на фоне диеты с низким содержанием меди. Раннее изменение рациона у собак, имеющих генетический дефект, связанный с медным токсикозом, может предотвратить или отсрочить появление клинических признаков.

Однако, если болезнь, связанная с нарушением накопления меди, уже развилась, следует назначить агенты, образующие комплексные соединения с медью, например – D-пеницилламин (10-15 мг/кг перорально два раза в день), чтобы попытаться снизить содержание меди в печени.

Противосудорожные препараты

Противосудорожные препараты, по-видимому, являются наиболее частой причиной ятрогенного заболевания печени у собак, но редкой причиной – у кошек, поскольку кошек переводят на противосудорожную терапию значительно реже, чем собак. Фенобарбитал, примидон или фенитоин могут вызвать хроническое заболевание печени.

Клинические признаки у собак с заболеванием печени, вызванным противосудорожными препаратами, сходны с клиническими признаками у собак с другими хроническими заболеваниями печени, например – анорексия, сонливость, снижение массы тела, желтуха, асцит и геморрагический диатез. Кроме того, у собак могут наблюдаться атаксия, седативный эффект и снижение частоты судорожных припадков.

Диагноз заболевания печени, вызванного противосудорожными препаратами, можно заподозрить у пациентов с приемом противосудорожных препаратов в анамнезе и с клиническими признаками заболевания печени и/или с повышенной активностью ферментов печени в сыворотке. Следует отметить, что противосудорожное лечение фенобарбиталом, примидоном и фенитоином повышает активность ферментов печени, но не вызывает повышения активности ферментов печени в сыворотке, которое свидетельствует о поражении печени. Тем не менее, резкое возрастание активности ферментов печени, клинические признаки заболевания печени и маркеры заболевания печени, такие как концентрация желчных кислот в сыворотке или концентрация альбумина в сыворотке, могут быть полезными для постановки диагноза. Также полезным является ультразвуковое исследование брюшной полости с целью выявления изменений в паренхиме печени.

Лечение заболевания печени, вызванного противосудорожными препаратами, включает в себя перевод пациента на другой противосудорожный препарат, например – на бромид калия, и, возможно, поддерживающую и симптоматическую терапию, описанную выше.

Диазепам 

Диазепам использовали как стимулятор аппетита у кошек. Однако у некоторых кошек развился смертельный некроз печени. Если у кошек, получающих лечение диазепамом, появляются клинические или биохимические признаки поражения печени, то лечение необходимо немедленно прекратить и при необходимости начать поддерживающую или симптоматическую терапию.

Карпрофен

Карпрофен – это нестероидное противовоспалительное средство, используемое для лечения хронического артрита у собак. Карпрофен ассоциирован с идиосинкратическим поражением печени к собак. Сообщалось, что повышен риск для лабрадоров-ретриверов.

Лечение включает в себя прекращение приема карпрофена и, при необходимости, поддерживающую и симптоматическую терапию.

Многие другие лекарственные препараты могут вызывать поражение печени. Однако в большинстве случаев эти поражения считают идиосинкратическими реакциями, развиваются они остро, и предсказать их невозможно.

Гепатит у кошек — симптомы и лечение

Этот медицинский диагноз описывает воспалительные процессы, которые происходят в тканях печени. Поскольку у кошек гепатит проявляется неспецифичными симптомами, то и выявить недуг вовремя не всегда удается. Итак, узнаем об особенностях этой болезни у домашних питомцев и ее терапии.

Виды гепатита

Существует немало факторов, которые приводят к воспалению тканей печени. В зависимости от них различают токсический и инфекционный гепатит у котов. Последний развивается как осложнение грибковых, вирусных, бактериальных инфекций, например, энтерита и лептоспироза. В группе риска развития инфекционного гепатита — пожилые кошки и невакцинированные молодые. Когда животному, к примеру, сделана прививка от чумки, но оно все-таки заболело, тогда риск возникновения инфекционного гепатита очень низкий. Привитые животные гораздо легче переносят недуг, скорее поправляются.

Токсический вид заболевания в большинстве случаев бывает результатом отравления химикатами, ядами, лекарствами, некачественным кормом. Все попадающие в организм токсины проходят через печень, и ее клетки очищают кровь от вредных компонентов. Заметим, что при кратковременном воздействии ядов и своевременной реакции хозяина токсический гепатит у кошек успешно лечится. Если же яды месяцами проникали в организм домашнего питомца, незаметно и постоянно разрушали клетки печени, то в полной мере восстановить работу органа не получится.

Стоит упомянуть и о таком виде опасности для печени, как гельминты. Они разрушают целостность органа и отравляют его продуктами своей жизнедеятельности. В таких ситуациях лечение гепатита сводится к борьбе с глистами. Но поскольку антипаразитарные препараты негативно действуют, прежде всего, на печень, то есть риск спровоцировать токсический гепатит. Если же в печени паразитов много, то мертвые будут раскладываться и еще больше отравлять орган. Кошка в этом случае может умереть от интоксикации.

Что касается вирусного гепатита, то, в отличие от собак, у кошек он не выявлен.

О признаках гепатита

Для всех видов заболевания существуют общие симптомы. Это изменение окраса слизистых оболочек и конъюнктивы глаз на желтый цвет; потеря аппетита; повышение температуры тела; позывы к рвоте; диарея, переходящая в запор. Кота мучит сильная жажда, и он часто пьет, при этом жадно глотает воду. Кал питомца становится серо-желтым или светлым. Моча животного приобретает темный цвет из-за присутствующих в ней белка, билирубина, желчных пигментов. Животное резко теряет вес. Как видим, признаки недуга схожи с болезнями системы пищеварения.

Если печень кота пальпировать, то это ему доставит боль и сильный дискомфорт. Орган увеличивается.

Внимательный хозяин всегда замечает изменения в поведении кошки, ее внешнем виде. Если же он пропустит вышеуказанные признаки, то острая форма гепатита просто перетечет в хроническую.

О лечении кошачьего гепатита

Терапия этого заболевания у животных базируется на устранении причин, которые его вызвали. Основой лечения является соблюдение диеты. Она кошке рекомендуется с первого дня после выявления недуга. Сначала ветеринары советуют день-два кошку не кормить, а только отпаивать минеральной водой. При отказе от питья надо вливать жидкость в пасть пипеткой или шприцом без иглы. После такой очистки в рацион кота вводят каши. Но без масла! Лучше сварить животному овсянку или манку. С кашами можно чередовать нежирные бульоны, легкие супы. Питье кошки, больной гепатитом, — это отвар шиповника и ромашки. Они восстанавливают работу желудка и печени. Только через неделю в рацион больного животного разрешается вводить отварное мясо и нежирные молочные продукты.

С десятого дня можно насытить рацион питомца овощами, кашами с маслом, рыбой и другими привычными продуктами в небольшом количестве.

Что касается лекарственной терапии, то она направлена на восстановление здоровой работы печени. Ветеринары с этой целью назначают витамин В, антибактериальные препараты, спазмолитики. Кошкам раствор глюкозы с витамином С вливается внутривенно. Это уничтожает токсичные вещества и препятствует обезвоживанию организма заболевшего.

Внимательный хозяин кота при первых признаках неблагополучия обязан сразу же обратиться к ветеринарному специалисту. Только так можно полностью вылечить гепатит.

Вопросы и ответы – «ГЕПАТИТ.РУ»

  1. Главная
  2. Вопросы и ответы


Вопрос: Скажите пожалуйста появление хр.панкреатита при хр. гепсе отражает состояние печени(развитие гепса)? т.е. если панкреатит,то фиброз не менее 2-го к примеру…… или дело к циррозу….??? заранее спасибо.

Ответ: Панкретит может быть никак не связан с гепатитом С и не влияет на степень фиброза. Что вы имеете ввиду под «дело идет к циррозу» я не поняла. Фиброз 2 не дает оснований для таких заключений.

Вопрос: Сделала фиброскопию печени: 7.0 баллов что соответствует 1 ст фиброза. даже уже почти2 .Как скоро можно проводить повторную терапию?, доктор сказал что ни чего страшного можно подождать года 2 пока не придумают третий препарат к терапии. посоветовал провести биопсию.

Ответ: Не вижу оснований делать биопсию. При фиброзе 1-2 можно не очень торопиться с лечением, но и откладывать надолго не стоит.

Вопрос: Что делать если поцарапал кот через 4 часа после того как поцарапал инфицированого геп.с.обработали рану йодом через час после того как получил царапину.есть риск заразиться? а вообще коты тоже могут быть переносчиками?

Ответ: На этот вопрос невозможно ответить однозначно. Поэтому просто сделайте анализ на вирус (на антитела) сейчас и потом через 6 месяцев. Только так можно получить тот ответ, который вы ждете: да или нет. Коты не могут быть переносчиками. У вируса гепатита С нет переносчика. Он передается непосредственно от человека к человеку. Мы обсуждаем передачу вируса через кровь зараженного человека, следы которой могут быть во внешней среде (на предметах, например, ножницах,зубных щетках, когтях кота).

Вопрос: Доброго времени суток Белла Леонидовна! У мена гепатит С с 1994г(вливали кровь во время родов).ПВТ не получала никогда,периодически принамала гептрал,эссенциале,фосфоглив.В прошлом(1999г) у нас в Калининграде появился фиброскан,мои показатели 5,1 кПА-F-0.АЛАТ за 1год-от 60 до-40,АСАТ-от 42 до 44. Решила 21.05 поехать сделать фиброскан и результат меня расстроил очень-6,4кПа F-1,пришла к своему врачу,он мне назначил фосфоглив внутривенно на пол года,ПВТ не хочет,потому что имеется крапивница+ВСД+ПА.Другой врач с которым я работаю настаивает на ПВТ!? Посоветуйте что лучше сделать? И еще забыла,я сейчас принимаю урсофальк,мог ли он как то повлиять на эти сопротивления(не знаю как правильно сказать) фиброскана? Последняя вир.нагр. от 03.02.10 3,5*10,4степени,ген 3а.

Ответ: Фиброз 1 не повод для того, чтобы очень расстраиваться и также, на мой взгляд, не повод для назначения внутривенного фосфоглива. Я бы рекомендовала вам начать противовирусную терапию, но сначала напишите более подробно о возможных противопоказаниях, которые вашему врачу кажутся непреодолимыми препятствиями для назнчения ПВТ. Во всех случаях, назначение лечения должно быть взвешенным, с учетом всех обстоятельств. Что касается урсофалька (или урсосана), то это очень хороший препарат и прямо показан при вирусном гепатите. Он никак не может ухудшить показатели фиброза, совсем наоборот. По вирусной нагрузке (средняя) и хорошему генотипу ваши перспективы в лечении могут оцениваться как очень хорошие. Также в прогностическом плане низкий фиброз хороший показатель.

Вопрос: Уважаемый Доктор! Я решил поступать в ординатуру(интернатуру) по рентгенологии в этом году. У меня гепатит В, фиброз1, принимаю энтекавир 1,5года, ПЦР — со 2-го месяца приёма, ферменты в норме. Меня волнует вопрос вредности данной профессии по отношению к моему заболеванию, насколько опасным может быть рентгеновское излучение для печени, сможет ли оно быть причиной обострения или раннего возникновения ГЦК. Спасибо!

Ответ: Не думаю, что рентгеновское излучение влияет особым образом на процессы в печени, зараженной вирусом и на сам вирус. Специальных исследований не проводили.

Вопрос: Помогите разобраться в результате анализа: WBC 4.3 RBC 5.27 HGB 154 HCT 44.9 PLT 107 LYM 46 MXD 11.2 NEUT 42.8 LUM 2. И вообще что это за значения?

Ответ: Если это клинический анализ крови, полученный в качестве контроля противовирусного лечения, то все вполне допустимо. Комментировать анализ без дополнительной информации невозможно.

Всего: 46 страниц


Вы можете задать вопрос на нашем форуме

Острый паренхиматозный гепатит у кошек

Острый паренхиматозный гепатит у кошек — воспаление соединительно-тканной стромы печени. Процесс сопровождается дегенеративными некробиотическими изменениями, снижением защитно-барьерной функции, распадом печеночных клеток.  Гепатиты у кошек различаются по происхождению и течению. Подразделяются они на острые и хронические, первичные и вторичные формы.

 

Причины

 

К причинам возникновения острого паренхиматозного гепатита относят:

 

  • энтероколиты;
  • инфекционные или инвазионные заболевания;
  • отравление ядом;
  • ожоги тела и радиационные поражения;
  • гастриты;
  • продолжительное применение лекарственных препаратов;
  • токсикоз при беременности.

 

Симптомы острого паренхиматозного гепатита у кошек

 

При остром паренхиматозном гепатите у кошек в начале болезни проявляются следующие клинические признаки:

 

  • угнетенное состояние животного;
  • отсутствие аппетита;
  • температура тела повышена;
  • учащение дыхания;
  • печень увеличена;
  • истечение из носовых ходов с примесью крови;
  • слизистые оболочки с желтым оттенком.

 

При наличии перечисленных симптомов заболевания, необходимо немедленно обратиться к ветеринарному врачу, для оказания срочной ветеринарной помощи.

 

Диагностика

 

Диагноз ставится врачом-ветеринаром на основании собранных данных:

 

  • сбор анамнеза;
  • клинические исследования крови и мочи;
  • анализ желудочного сока;
  • просмотр гистопрепаратов;
  • исключение инвазионных заболеваний, цирроза печени, лептоспироза.

 

Лечение

 

Для лечения острого паренхиматозного гепатита у кошек врачом назначается комплексная терапия:

 

  • ежедневно давать животному минеральную воду;
  • вводить глюкозу, липокаин, инсулин, холосас, настой кукурузного рыльца, холензим и др.;
  • при осложненных формах давать кортизона ацетат, преднизолон;
  • давать слабительные препараты для устранения вредных продуктов из кишечника;
  • курс антибиотиков и сульфаниламидов для устранения обильного развития микробов;
  • организовать полноценное кормление;
  • соблюдать режим кормления;
  • устранить этиологический фактор;
  • скорректировать объем и дозу корма, необходимую для питомца;
  • создать оптимальные условия содержания кошки.

 

Опасность

 

При острой форме паренхиматозного гепатита снижается барьерная и обезвреживающая способность печени. Отмечается ряд последствий:

 

  • проникновение патогенных микроорганизмов из кишечника в общий кровоток;
  • высвобождаются продукты брожения и гниения;
  • происходит гепатогенная интоксикация организма;
  • на почве гипогликемии усиливается разложение жира;
  • отмечается ацидоз крови.

 

Профилактика

 

В качестве профилактических мероприятий владельцу животного следует соблюдать ряд правил по предупреждению паренхиматозного гепатита:

 

  • организовать полноценное кормление;
  • добавить к рациону витамины, белки, углеводы и минералы;
  • исключить из кормления недоброкачественные корма;
  • соблюдать режим кормления кошки;
  • создать оптимальные условия содержания животного;
  • своевременно лечить инфекционные заболевания и отравления;
  • периодически проводить клинический врачебный осмотр.

 

Внимание: написанное выше  служит исключительно познавательным целям, не является профессиональным медицинским советом и научным материалом.

Еще статьи:

Трещины и обламывания когтей у кошек – травматическое повреждение, в результате которого происходит гнойное воспаление венчика. В данном случае коготь выпадает.     Причины…

Врастание когтей у кошек – распространённое заболевание. Шпорные когти при сильном отрастании врастают в мякишные подушечки лап, вызывая воспаление мягких тканей. Передвижение вызывает боль и мя…

Ботулизм у собак является остропротекающей токсикоинфекцией. Заболевание вызывается токсином анаэробной спорообразующей палочки. Проявляется ботулизм парезами и параличами мускулатуры. Причины бо…

Гепатолюкс суспензия для кошек, фл. 25 мл

ИНСТРУКЦИЯ

по применению препарата Гепатолюкс (Gepatolux) суспензия

СОСТАВ И ФОРМА ВЫПУСКА

Лекарственный препарат, содержащий в 1 мл действующие вещества: фосфолипиды эссенциальные (лецитин) растительного происхождения из семян сои — 50 мг, метионин — 70 мг, соль глицирризиновой кислоты — 12,5 мг, глицин — 10 мг, L- аргинин — 50 мг, экстракт семян расторопши пятнистой (силимарин) — 15 мг, экстракт листьев артишока полевого — 20 мг, экстракт пчелиного маточного молочка — 1 мг и вспомогательные компоненты. По внешнему виду Гепатолюкс представляет собой суспензию светло-желтого цвета. Выпускают препарат расфасованным по 25 мл в полимерные флаконы, герметично укупоренные навинчивающимися крышками с контролем первого вскрытия, упакованные в картонные пачки в комплекте со шприцем-дозатором и инструкцией по применению.

ФАРМАКОЛОГИЧЕСКИЕ СВОЙСТВА

Активные компоненты препарата Гепатолюкс способствуют нормализации белкового, углеводного и жирового обмена, обладают выраженными гепатопротекторными свойствами, повышают антиоксидантную, барьерную, гомеостатическую и метаболическую функцию печени. Экстракты лекарственных растений оказывают желчегонное, гиполипидемическое и гипогликемическое (понижение уровня сахара в крови) действие, ускоряют процесс депонирования веществ в печени. Метионин является незаменимой аминокислотой, которая регулирует азотистый баланс в организме. Содержит подвижную метильную группу и участвует в процессах метилирования, обеспечивающих синтез холина, адреналина, креатина и др. биологически важных соединений, обезвреживания токсичных продуктов и образования фосфолипидов. Тормозит отложение в печени нейтрального жира, оказывает липотропный эффект (удаление из печени избытка жира). Фосфолипиды эссенциальные (лецитин) относятся к классу высокоспециализированных липидов и представляют собой сложные эфиры глицерофосфорной кислоты. Являются основными элементами в структуре клеточной оболочки и митохондрий, регулируют липидный и углеводный обмен, улучшают функциональное состояние печени и ее дезинтоксикационную функцию, способствуют сохранению и восстановлению структуры гепатоцитов; тормозят формирование соединительной ткани в печени. L-аргинин — алифатическая аминокислота, которая ускоряет выведение из организма продуктов белкового обмена, снижает уровень холестерина, улучшает работу ферментативных систем и трофику тканей. Экстракт листьев артишока полевого обладает желчегонным, дезинтоксикационным, гепатопротективным, гиполипидемическим и диуретическим действием. Повышает выведение из организма мочевины, токсинов (нитросоединений, алкалоидов, солей тяжелых металлов), способствует уменьшению содержания холестерина в крови. Экстракт расторопши пятнистой (силимарин) обладает антиоксидантными и мембраностабилизирующими свойствами, препятствует накоплению гидроперекисей липидов, тем самым уменьшает повреждения клеток печени и замедляет поступление в них токсических веществ. А также активирует и нормализует белковый и жировой обмен. Соль глицирризиновой кислоты стимулирует желчеотделение и улучшает функционирование печени, оказывает противовирусное, спазмолитическое и противовоспалительное действие. Глицин является регулятором обмена веществ, нормализует и активирует процессы защитного торможения в центральной нервной системе, повышает выносливость животного. Оказывает антиоксидантное и антитоксическое действие. Экстракт пчелиного маточного молочка способствует быстрому восстановлению и выведению токсических веществ, ядов и тяжелых металлов из организма, нормализует внутриорганное давление, повышает иммунную систему, улучшает функцию почек и печени, снижает уровень сахара в крови, а также оказывает выраженное противовоспалительное, гепатопротекторное, кардиопротекторное и адаптогенное действие.

После приема внутрь компоненты препарата хорошо всасываются в тонком кишечнике, в том числе в виде биологически активных продуктов их гидролиза пищеварительными ферментами, которые транспортируются через стенку кишечника в лимфатическое русло и в печени происходит частичный ресинтез из них. Гепатолюкс по степени воздействия на организм теплокровных животных относится к малоопасным веществам (4 класс опасности по ГОСТ 12.1.007-76). В рекомендуемых дозах не оказывает эмбриотоксического, тератогенного, мутагенного и сенсибилизирующего действия.

ПОКАЗАНИЯ

Гепатолюкс применяют кошкам для профилактики и лечения острых и хронических заболеваний печени (гепатиты, гепатозы, жировая дистрофия и дегенерация печени), желчного пузыря и желчевыводящих путей различного генеза. Комплексный состав препарата способствует регенерации клеток печени, улучшению ферментной активности, нормализации всех видов обмена веществ, повышению аппетита и усвояемости у животных. Препарат эффективен при интоксикациях, отравлениях и состояниях обезвоживания организма; снижает побочные действия химиотерапевтических, противопаразитарных и других лекарственных средств, обладающих гепатотоксичностью. Гепатолюкс улучшает свойства желчи и уменьшает риск образования желчных камней у животного. Применение препарата значительно снижает риск возникновения цирроза и рака печени у животных. Рекомендовано применение препарата Гепатолюкс животным группы риска: кастрированным, стерилизованным, склонным к полноте, малоподвижным и пожилым.

ДОЗЫ И СПОСОБ ПРИМЕНЕНИЯ

Перед применением флакон с суспензией необходимо тщательно встряхнуть.

Гепатолюкс задают внутрь индивидуально во время кормления кошке в дозе 0,1 мл на 1 кг массы 2 раза в день или непосредственно вливают в защечную область при помощи шприца-дозатора. Курс применения составляют 20-30 дней, в зависимости от индивидуальных особенностей организма и характера течения заболевания. При необходимости по указания ветеринарного врача прием препарата можно возобновить через 10 дней. При хроническом течении заболевания курс лечения повторяют несколько раз в год.

Применение Гепатолюкса не исключает использования других этиотропных и патогенетических лекарственных средств. Препарат назначают самостоятельно или в составе комплексной терапии.

Симптомы передозировки у животных не выявлены.

ПОБОЧНЫЕ ДЕЙСТВИЯ

При применении препарата в соответствии с настоящей инструкцией не наблюдаются.

При индивидуальной непереносимости компонентов препарата и проявлении аллергических реакций, применение препарата следует прекратить.

В очень редких случаях, через несколько минут после применения препарата у животных возможно появление повышенного слюноотделения, которое самопроизвольно прекращается.

ПРОТИВОПОКАЗАНИЯ

Индивидуальная повышенная чувствительность к компонентам препарата.

Не рекомендуется назначать животным с печеночной энцефалопатией и тяжелой формой почечной недостаточности.

ОСОБЫЕ УКАЗАНИЯ

Препарат Гепатолюкс совместим с лекарственными средствами и кормовыми добавками. Применение беременным и кормящим животным осуществляется только под наблюдением ветеринарного врача.

Меры личной профилактики

При работе с препаратом Гепатолюкс следует соблюдать общие правила личной гигиены и техники безопасности, предусмотренные при работе с лекарственными препаратами. Пустые флаконы из-под препарата утилизируют с бытовыми отходами. Неиспользованный препарат утилизируют в соответствии с требованиями законодательства.

УСЛОВИЯ ХРАНЕНИЯ

Хранить в закрытой упаковке производителя, в защищенном от света и влаги месте, отдельно от пищевых продуктов и кормов, при температуре от 0°С до 25°С. Срок годности при соблюдении условий хранения — 2 года от даты производства. Открытый флакон хранят в холодильнике не более 20 суток. Не использовать по истечении срока годности. Дата производства указана на упаковке. Применять препарат только по назначению. Не использовать пустые флаконы для бытовых целей.

Хранить в недоступном для детей месте!

Отпускается без рецепта ветеринарного врача.

 

симптомы и лечение, прогноз, передается ли человеку, питание

Гепатит у кошек — это патология, которая оказывает сильное воздействие на печень. Поскольку печень представляет собой очень важную часть организма, то ее воспаление приводит к последствиям для всего организма.

Гепатит у кошки этиология и патогенез

Гепатит у кошек как и у людей является заболеванием, которое протекает на фоне воспаления печени. Как известно, это крайне важный орган, который играет серьезную роль в работе организма. Именно поэтому при возникновении заболевания очень важно начать своевременную терапию. Ведь если этого не сделать последствия для животного могут крайне тяжелыми.

Причины развития и виды гепатита

Возникновение любого заболевание связано со многими факторами, начиная с физического состояния кота или кошки и заканчивая их образом жизни. На данный момент специалисты выделяют два типа заболевания, а именно инфекционный и неинфекционный.

Неинфекционный токсический

Данный вид заболевания развивается из-за отравления животного химикатами, плохим кормом и из-за воздействия кожных и желудочных паразитов. При этом нужно помнить, что уничтожение паразитов специальными средствами также оказывает негативное влияние на печень кошки, а значит, может способствовать развитию гепатита.

В подобных препаратах используются яды, которые в дальнейшем перерабатываются именно печенью. Также кошки могут съесть отравленную мышь, и это приведет к возникновению патологии.

Инфекционный бактериальный грибковый вирусный гепатит

Этот тип патологии обычно возникает вследствие атаки организма паразитами или болезнетворными бактериями. Причем даже если патогенные клетки не нацелены на поражение конкретного органа, их жизнедеятельность приводит к возникновению болезни. В некоторых случаях вирусный гепатит у кошек возникает на фоне осложнений, связанных с другими инфекциями.

Симптомы

Симптомы, указывающие на то, что кошка заболела гепатитом, могут быть самыми разными. Однако первое, что укажет на возникновение патологии, это пожелтевшая слизистая оболочка органа. Такое явление специалисты называют паренхиматозной желтухой. Кроме того гепатит у кошки характеризуется такими проявлениями:

  • повышение температуры из-за атаки патогенных бактерий микрофлоры организма животного;
  • потеря аппетита, а в некоторых случаях даже полный отказ от приема еды;
  • постоянное желание утолить жажду;
  • периодическая рвота;
  • расстройство желудка, которое делает жизнь кошки мучительной;
  • животное начинает резко терять в весе из-за нарушений в работе печени.

Также в этот период кошки стараются избегать общения с людьми могут проявлять агрессию и не хотят, чтобы к ним прикасались.

Если говорить о токсическом гепатите, то он также имеет определенные симптомы, среди которых следует отметить:

  • постоянный зуд кожных покровов, в некоторых случаях наблюдается шелушение кожи;
  • появление сыпь или другие типы аллергической реакции;
  • в некоторых местах кожа начинает кровоточить из-за воздействия патологии

Когда животное долгое время подвергается воздействию ядовитых элементов, заболевание может перейти в хроническую форму. Это приводит к постоянным воспалениям брюшной полости, что чрезвычайно болезненно и приносит кошке большие страдания.

При подобных заболеваниях крайне важно вовремя выявить патологию, увидеть ее признаки у котов и начать лечение. В противном случае животное может получить серьезные осложнения, которые иногда приводят к смертельному исходу.

Диагностика

Поставить диагноз может только ветеринар после того, как животное будет осмотрено а также у него будут взяты пробы и анализы. Такое обследование можно провести в специализированных клиниках.

При первых признаках гепатита владельцам кошки нужно в максимально короткие сроки показать ее специалисту, который проведет обследования и назначит лечение в случае необходимости.

Как и чем лечить

Сразу после того как животному поставлен диагноз инфекционный гепатит, ветеринар назначает курс терапии. Это комплексное лечение, основной целью которого является устранение причины возникновения болезни.

Если животное страдает от токсического гепатита, специалист должен первым делом определить, какие именно вещества спровоцировали болезнь. После чего предотвратить их дальнейшее поступление в организм.

Кроме того лечение гепатита у кошек предполагает применение различных препаратов, которые могут очищать кровь и таким образом облегчать работу печени. Для этого животным назначают — Викасол, препараты, содержащие витамины группы K.

Чтобы поддерживать печень в работоспособном состоянии ветеринар выписывает животному таблетки, которые укрепляют клетки этого органа — Эссенциале Форте, витамины группы B. Кроме того назначаются различные составы, которые противодействуют микробам, повышают общий тонус — Амоксиан.

Чтобы уменьшить боль, вызванную развитием гепатита, кошкам назначают спазмолитики — Дротаверин, Но-шпу.

Специалисты не рекомендуют владельцам домашнее лечение без надзора ветеринара. В некоторых случаях возможно лечение народными средствами: отварами растений и трав. Однако оно должно сочетаться с медицинскими препаратами.

Кормление кошек при гепатите

Лечение гепатита во многом зависит от того, чем будет питаться кошка в процессе выздоровления. Ветеринары рекомендуют вместо обычного питания составить полезную и простую диету. Выглядит она следующим образом:

  1. В первый день после того как животному поставили диагноз его не следует кормить. Причем часто бывает так, что у кота или кошки в этот момент нет аппетита.
  2. На второй день можно дать бульон и немного говяжьего мяса. Рыба и мясо птицы в этот момент строго запрещены.
  3. На третий день можно отварить немного риса или овсяной каши. Если к этому времени животное сильно истощало можно добавить к каше паштет.
  4. На четвертый и пятый день по совету врачей стоит приготовить молочный корм, йогурт можно немного творога. При этом хозяевам нужно смотреть на то, как кошка будет реагировать на эти продукты.
  5. На шестой седьмой день стоит приготовить овощную пищу (например, морковку, перемешанную с йогуртом).

Осложнения после гепатита

К сожалению даже самые современные методики не гарантируют, что гепатит не вызовет осложнений. В том числе это касается таких заболеваний как: энцефалотопия, липидоз, асцит, хронический гепатит кошек.

Профилактика

Владельцам кошек, чтобы избежать возможных заболеваний своего питомца, следует придерживаться простых правил:

  • своевременная иммунизация;
  • профилактика развития аллергии;
  • регулярная дегельминтизация.

При соблюдении этих правил кошачий гепатит никогда не беспокоит животное.

Передается ли гепатит от кошки человеку

По заверениям специалистов заразиться гепатитом от кошки невозможно. На данный момент не зафиксировано случаев, когда болезнь передавалась людям. Однако существует риск, что заразятся другие питомцы, если они есть в доме.

симптомы и лечение желтухи разной этиологии, прогноз


Такое коварное заболевание, как гепатит, диагностируется не только у людей, но и у животных. Эта патология наносит тяжелый удар по организму. Воспалительные процессы нарушают работу печени, поэтому она не выполняет свои функции в полном объеме. Питомцы переносят заболевание очень тяжело. В их организме накапливаются токсины, нарушаются обменные процессы, ухудшается общее состояние.

Как проявляется желтуха у кошек? Что является причиной гепатита у домашних животных? Почему появляется желтушность слизистых покровов? Как помочь питомцу при заболевании печени? Передается ли кошачий гепатит человеку? Сколько живут кошки после гепатита? Проходит ли желтуха сама?

Что такое гепатит и каким он бывает?

Гепатит – одна из патологий печени, при которой происходит разрушение структурных клеток органа. Вследствие этого процесса печень перестает нормально работать. Снижается ее защитная и кроветворная функция. Токсины накапливаются в организме. Отсутствие лечения при заболеваниях печени приводит к тяжелым последствиям. В зависимости от провоцирующих факторов гепатит у кошек бывает:

  • аллергическим;
  • токсическим;
  • инфекционным.

Все формы патологии характеризуются сходными признаками, но лечение назначается исходя из причин, вызвавших болезнь. Эффективность терапии зависит от правильной постановки диагноза и уточнения этиологии болезни на основании обследования.

По интенсивности симптомов и продолжительности течения гепатит бывает острым и хроническим. При острой форме заболевания признаки всегда ярко выражены, а развитие патологии происходит стремительно. Хронический гепатит представляет собой смену периодов обострения временной ремиссией. Чаще всего хроническая форма возникает при неадекватном или несвоевременном лечении, несоблюдении рекомендаций ветеринара, регулярном контакте с ядовитыми веществами, сильных гельминтозах.

Почему возникает

Воспалительные процессы в печени при гепатите у кота сопровождаются разрушением печеночных клеток и они уже не могут работать в полную мощность. Все это приводит к ослаблению защитной и барьерной функции.


Сильнодействующие лекарства как причина гепатита

Причин к возникновению болезни может быть масса:

  • воздействие инфекционных агентов,
  • отравление ядами минерального, промышленного или растительного происхождения,

    Это надо знать! Яды могут попадать в организм не только через рот, но и через кожу или с вдыхаемым воздухом.

  • использование в рационе испорченных продуктов или кормов низкого качества. Например, постоянное кормление заплесневелыми, запревшими кормами рано или поздно приведет к сбою в работе печени из-за сенсибилизации организма микотоксинами,
  • неправильно подобранная доза лекарственных средств или схема лечения. Так известно, что некоторые антибиотики и сульфаниламидные препараты имеют свойство аккумулироваться (накапливаться), приводя к гепатиту аллергического характера.

Это надо знать! Инфекционные агенты — вирусы, бактерии, микроскопические грибки. Негативно на печень влияют как сами патогенные микроорганизмы, так и токсины, которые они продуцируют в процессе своей жизнедеятельности.

В качестве предрасполагающих факторов, приводящих к патологии можно выделить застой в печеночной вене и слабый иммунитет питомца.

Причины гепатита у кошек

Все известные формы гепатита у кошек возникают под действием разных факторов. Аллергическая желтуха появляется в результате осложнений, возникающих на фоне вирусного, бактериального поражения или действия токсинов. Аллергическая реакция в виде желтушности слизистых оболочек обычно сопровождается кожными симптомами, такими как крапивница, зуд. Для лечения подобных состояний применяются антигистаминные средства.

Виды гепатита

ИНФЕКЦИОННЫЙ гепатит

у кошек развивается как осложнение вирусных, грибковых и бактериальных инфекций (лептоспироз, энтерит, чумка и т.п.). В группе риска – не вакцинированные молодые и пожилые питомцы. Если любимице сделана прививка, например, от чумки, но кошка все-таки заболела, маловероятно, что течение болезни осложнит инфекционный гепатит у кошек, так как привитые питомцы легче переносят недуг и быстрее выздоравливают. Симптомы: собственно гепатита плюс характерные для основного заболевания.

ТОКСИЧЕСКИЙ гепатит

у кошек – это результат отравления печени ядами, химикатами, некачественным кормом, лекарствами и т.п. Все токсины, попавшие в организм, проходят через печень, клетки которой очищают кровь от вредных составляющих. В большинстве случаев токсический гепатит у кошек лечится, если действие ядов было кратковременным. Если яд проникал в организм годами, медленно и незаметно разрушая клетки печени, восстановить функции органа в полной мере часто не удается.

Отдельного внимания заслуживают гельминты

. Одни виды глистов внедряются в ткани печени, разрушая целостность органа различными приспособлениями для фиксирования (крючки, присоски и т.п.). Другие отравляют печень продуктами жизнедеятельности и распада. В этом случае лечение гепатита у кошек сводится к борьбе с паразитами, однако существует опасность нанести печени еще больший вред. Так как лечить гепатит у кошек приходится с применением ядов (глистов ведь попросту травят), есть риск спровоцировать токсический гепатит. Кроме того, если паразитов слишком много, мертвые гельминты отравляют печень продуктами разложения – кошка может погибнуть от интоксикации. Поэтому крайне важно не допускать инвазии, регулярно давая питомцу средство от внутренних паразитов.

ВИРУСНЫЙ гепатит

у кошек, в отличие от собак, не выявлен. То есть не существует вируса, который провоцирует кошачий гепатит. Хотя это определение довольно часто можно услышать от владельцев и даже от ветеринарных врачей. Последние, по всей видимости, под формулировкой «вирусный гепатит у кошек» подразумевают гепатит как результат вирусной инфекции. Иногда владельцы просто не видят разницы между инфекцией и вирусом или путают вирусный перитонит с вирусным гепатитом. Стало быть, так называемый вирусный гепатит у кошек симптомы проявляет смешанные: собственно гепатита и того вируса, которым заражена кошка (панлейкопения, коронавирус, кальцивироз и др.).

Симптомы заболевания

При заболеваниях печени питомцы обычно проявляют беспокойство, как только врач или хозяин касается части живота, где она расположена. Любая попытка приласкать кота, взять его на руки вызывает у него недовольство.

В условиях ветеринарной клиники гепатит диагностируют при помощи анализа крови. Лабораторное исследование показывает количество общего билирубина в крови. Специалист может сделать выводы, зная значения билирубина в норме. При поражении печени этот показатель повышен. Заподозрить у своей любимицы проблемы с печенью внимательный хозяин может по следующим симптомам:

  • Желтый оттенок кожных покровов, слизистых оболочек и склер глаз. Это самый яркий признак нарушения работы печени. Обращаться к специалисту надо немедленно, если у животного пожелтел рот, уши, конъюнктива или белки глазных яблок. Желтушность становится более заметной, если заболевание прогрессирует, и уходит после восстановления работы печени.
  • Бесцветный или очень светлый кал. Цвет кала зависит от билирубина, который присутствует в желчи. При гепатите кал практически не окрашивается.
  • Нарушение стула. Чаще у кошек отмечается понос, реже возникают запоры.

Лечение гепатита разной этиологии у кошек

Терапия, в первую очередь, направлена на устранение источника патологии. Это помогает остановить прогрессирование болезни и развитие осложнений.

При токсическом поражении печени проводится дезинтоксикация организма, направленная на выведение ядов. Если хозяин знает, каким веществом отравилась кошка, ветеринар может подобрать антидот. Для поддержания работы печени назначают гепатопротекторные препараты. Они ускоряют восстановление поврежденных участков. Кроме того, животным дают средства, усиливающие отток желчи.

Вирусные формы патологии лечатся противовирусными препаратами. В тяжелых случаях, если болезнь обнаруживают на поздних стадиях, или при возникновении угрозы для жизни питомца проводится терапия кортикостероидами.

Заболевания печени неизбежно приводят к нарушению пищеварения, поэтому при гепатите надо соблюдать диету, рекомендованную ветеринарным врачом. В течение первых суток кошка может только пить воду, затем в рацион вводят нежирный рыбный или мясной бульон. Когда питомцу становится лучше, его начинают кормить диетическими супами. К привычному для животного рациону переходят через 10 дней терапии. Сухой корм лучше заменить на лечебный, который отличается меньшим содержанием белка.

Профилактика

Чтобы предотвратить воспаление печени, следует выполнять нижеперечисленные правила:

  • обеспечить полноценное питание готовыми кормами премиум-класса или выше, либо равнозначной кормосмесью из натуральных продуктов;
  • следует предпочесть сухие корма влажным, поскольку они не портятся, или утилизировать остатки еды;
  • не угощать питомца продуктами питания человека;
  • регулярно иммунизировать кошку в соответствии с планом прививок;
  • проводить ежеквартальную дегельминтизацию.

Если питомец проживает в квартире многоэтажки, надо применять готовые корма, предотвращающие ожирение. Пожилым кошкам скармливают питание для сеньоров, учитывающее преклонный возраст и наличие хронических заболеваний.

Сколько времени лечится гепатит, какие возможны осложнения?

Гепатит, как правило, быстро не проходит. При своевременном обращении, когда лечение начинается на ранних стадиях болезни, улучшение наступает спустя 7–14 дней. Однако длительность терапии зависит не только от вовремя принятых мер, но и от иммунитета питомца, его возраста, типа возбудителя патологии. Самостоятельно лечить животных от желтухи нельзя. Назначения делает только ветеринар, основываясь на результатах анализов и состоянии кошки.

Риск развития осложнений при гепатитах очень высок, поэтому так важно вовремя поставить правильный диагноз. Нарушение работы печени может привести к следующим осложнениям:

  • липидоз – замещение структурных клеток печени жировой тканью вследствие того, что питомец долго не ест;
  • энцефалопатия – поражение мозга в результате продолжительной интоксикации организма продуктами метаболизма;
  • асцит (водянка) – выпот лимфатической жидкости в брюшную полость;
  • цирроз – необратимая патология, при которой клетки печени постепенно замещаются фиброзными.

Прогноз и возможные последствия заболевания для кошки

Продолжительность жизни кошек зависит от того, когда было начато лечение. Прогноз также во многом определяется причиной заболевания. Для восстановления здоровья питомцу потребуется особое внимание хозяина, который будет своевременно давать коту лекарства, кормить, соблюдая диету, назначенную ветеринаром.

При остром течении болезни хозяину придется запастись терпением, так как при малейшем ухудшении состояния животного нужно вызывать специалиста на дом. Необходимо внимательно наблюдать за цветом кала и мочи кошки. Именно по изменению цвета испражнений можно быстро догадаться, что животному нужна срочная помощь. В таких случаях медлить нельзя.

Чаще всего полное выздоровление при гепатите не наступает. Патология не проходит бесследно, поэтому специалисты рекомендуют владельцам кошек переводить своих любимцев на специальные корма, поддерживающие нормальную работу печени. Рацион питомца должен включать минимальное количество жиров. Пища должна быть богата витаминами. После лечения следует посоветоваться с лечащим врачом о том, какие продукты лучше давать кошке, чтобы поддержать ее здоровье и продлить жизнь.

Заразен ли кошачий гепатит, передается ли он человеку и другим животным?

Кошачий гепатит отличается от человеческого прежде всего причинами возникновения. Возбудители гепатита у людей не те же самые, что у кошек. Кроме того, человеческая патология имеет иную клиническую картину. Можно с уверенностью утверждать, что гепатит домашнего питомца не опасен для человека, хозяин не может заразиться им от кота.

Научно доказано, что гепатит не передается и от одного животного другому. Если одна из кошек, живущих в доме, заболела, то ее не нужно изолировать, так как она не представляет опасности. Если патология вызвала глистной инвазией, то другие питомцы могут заразиться гельминтами, но это не означает, что у них также разовьется гепатит.

Поделитесь с друьями!

Функции печени

Давайте начнем с основ, для того чтобы понимать весь масштаб ситуации. Разберемся в том, какие функции выполняет печень и у кошек.

Пищеварительная и регулирующая обмен веществ

Печень также участвует в процессе пищеварения, хотя точнее сказать, что этот орган – связующее звено между пищеварительной и кровеносной системами. Белки и жиры расщепляются благодаря работе печени (однако она не только расщепляет поступающие вещества, но и образует новые, необходимые для жизнедеятельности). Не стоит забывать и про гликоген, который запасает до «черных дней». К тому же печень регулирует выброс гормонов (в частности, адреналина и норадреналина).

Образование и выделение желчи

А выводится она в двенадцатиперстную кишку. Именно она помогает расщеплять пищу (однако она выполняет еще несколько функций, о которых вы узнаете из текста ниже). Желчь образуется в клеточках печени, используя для этого кровь. Когда гемоглобин разрушается, образуется билирубин, который и является желчным пигментом. Желчь помогает активизировать ферменты (в частности, липазу), которые и расщепляют пищу.

Всасывание жиров и синтез витаминов

Скорее эту функцию можно «присвоить» желчи, которая (как уже было написано выше) эмульгирует жиры. А вот они могут всосаться только после того, как соединятся с желчными кислотами. После того, как желчный пузырь «отдаст» скопившийся в нем секрет, кишечник начинает лучше сокращаться (перистальтика усиливается, что способствует нормальному продвижению пищи по ЖКТ).

В печени образуется витаминка А, а также «складируется» витамин К и «никотинка».

Регулирование уровня глюкозы в крови

Из предыдущего пункта «вытекает» следующая функция печени – регулирование уровня глюкозы в крови. Как только он повышается, печень сразу же начинает делать «запасы», образуя и откладывая гликоген. Когда же глюкозы не хватает, эти запасы разрушаются, в результате в крови сахар приходит в норму. Однако если у питомца регистрируются проблемы с концентрацией глюкозы в крови, но печень абсолютно здорова, то, скорее всего, у кошки сахарный диабет.

«Очищение» и «хранение» крови

Избыточное количество медикаментов/гормонов/витаминов, «отходы» метаболизма – все это «оседает» в печени. Но если такой «гадости» накапливается слишком много, то печень начинает погибать, а токсины вновь с кровью разносятся по всему организму, отравляя его. Печень хорошо снабжена кровеносными сосудами. Кровь через этот орган не просто проходит, словно сквозь фильтр, но и задерживается. Поэтому если в результате ранения отмечается сильная кровопотеря, то печень «отдает» свои запасы, чтобы хоть как-то восполнить объем циркулирующей крови.

Защитная функция

Речь не только об очистке крови от токсинов, но и об обеззараживании от бактерий. Печень, «жертвуя» собой, по максимуму задерживает микроорганизмы (клетки способны к фагоцитозу). Поэтому даже если питомец заболевает сальмонеллезом (или иной микроб решит «насолить» усатику), то страдает печень. А ветеринар, заприметив симптомы инфекционного заболевания, а также признаки, характерные для воспаления печени, наверняка скажет вам, что у кошки вирусный гепатит. И это не из-за плохой квалификации специалиста или отсутствия опыта, нет, этот диагноз – общий. Как ОРВИ у нас. Врач же не говорит, какой именно возбудитель привел к воспалению респираторных путей у нас, также можно сказать и про вирусный гепатит у кошек.

Зачем нужна печень? Смотрим на коротком и понятном видео:

Новый вирус, похожий на вирус гепатита В, обнаружен у кошек

Когда кот Джулии Битти Джаспер умер от болезни сердца, ей и в голову не пришло, что его смерть приведет к прорывному открытию вируса, ранее неизвестного у кошек. Но теперь образцы его тканей помогли Битти и другим австралийским исследователям идентифицировать новое кошачье заболевание: гепаднавирус домашней кошки.

Вирус принадлежит к тому же семейству, что и гепатит B, поражающий людей, и обнаружение кошачьей версии может повлиять на медицинские исследования человека, а также на здоровье кошек.

Помимо того, что он владелец кошки, Битти, BVetMed, PhD, FANZCVSc, является профессором кошачьей медицины в Школе ветеринарии Сиднейского университета. Она была частью группы исследователей, которые обнаружили новый гепаднавирус во время поиска вызывающих рак вирусов в ткани кошки с ослабленным иммунитетом, которая умерла от лимфомы.

В этом месяце они опубликовали свои выводы в журнале Viruses .

Исследователи, финансируемые Фондом животных Морриса, смогли составить карту полного генома нового вируса, а затем протестировали ранее сохраненные образцы от других домашних кошек, включая Джаспера.

Хотя Джаспер умер от болезни сердца, на момент смерти у него также был диагностирован кошачий вирус иммунодефицита (FIV), кошачий эквивалент ВИЧ/СПИДа, который является распространенным заболеванием, которое, скорее всего, сделало его восприимчивым к новому вирусу. гепатитоподобный вирус.

Когда Битти и ее коллеги исследовали другие образцы, они обнаружили новый вирус у 10% кошек с положительным результатом теста на ВИК и у 3,2% кошек, не инфицированных ВИК.

Битти отметил, что хотя подобные вирусы могут вызывать гепатит и рак печени у других видов, недавно обнаруженный кошачий гепаднавирус не представляет опасности для людей или других домашних животных.

Битти сказал, что открытие было захватывающим по нескольким причинам: «До сих пор мы не знали, что животные-компаньоны могут заразиться этим типом инфекции. Очевидно, нам необходимо понять влияние этой инфекции на здоровье кошек».

И последствия не ограничиваются кошачьим здоровьем. «Как только мы узнаем о вирусе одного конкретного вида, он может иметь отношение и к другим видам», — сказал Битти.

«У нас есть вакцина против гепатита В [у людей], но мы до сих пор [полностью] не уверены, как она вызывает рак, и поэтому, чем больше видов, о которых мы знаем, у которых есть эти вирусы, тем больше мы можем узнать о том, как этот тип вируса взаимодействует со своим хозяином, каким бы млекопитающим это ни было.

«Если мы сможем найти вирусы, вызывающие опухоли, тогда мы сможем создать вакцину, защищающую от вируса, — сказал Битти. — Особенно интересно, если вакцина может предотвратить развитие рака в будущем у кошек с ослабленным иммунитетом или других уязвимых кошек».

И хотя Битти все еще скучает по Джасперу, она рада, что он смог помочь.

Фото: © iStock/Natali_Mis

Болезни печени у кошек — Болезни кошек

Что такое заболевание печени?

Печень является важным органом, выполняющим множество функций, включая переваривание и преобразование питательных веществ, удаление токсичных веществ из крови и хранение витаминов и минералов.Поскольку печень избавляет организм от множества различных веществ, она подвержена повреждениям из самых разных источников. Заболевание печени приводит к воспалению, известному как гепатит. Если не лечить, это может привести к потере функции, поскольку здоровые клетки печени заменяются рубцовой тканью. Заболевания в других частях тела также могут влиять на функцию печени.

К счастью, заболеванием печени можно эффективно управлять и ограничить его прогрессирование. Многие кошки продолжают жить счастливо спустя годы после постановки диагноза.Правильное питание и постоянный диалог с ветеринаром являются ключом к лечению заболеваний печени у вашей кошки.

Что вызывает заболевание печени?

Факторы, повышающие вероятность развития заболевания печени у вашей кошки, включают:

Возраст: Несколько заболеваний, включая дисфункцию печени, часто встречаются у пожилых кошек.

Порода: Некоторые породы, такие как сиамские кошки, чаще рождаются с определенными проблемами с печенью или предрасположены к ним.

Ожирение: Кошки с большим избыточным весом могут быть более склонны к развитию заболеваний печени.

Лекарства и химикаты: Лекарства, содержащие ацетаминофен, могут повредить печень у кошек.

Есть ли у моей кошки заболевание печени?

Признаки заболевания печени могут быть очень похожи на признаки других заболеваний. Если вы заметили какие-либо из следующих признаков у своей кошки, обратитесь к ветеринару для полного обследования.

Симптомы, на которые следует обратить внимание, включают:

  • Плохой или потеря аппетита
  • Внезапная потеря веса
  • Потеря веса
  • Желтуха (пожелтение десен, белков глаз или кожи)
  • Повышенная жажда
  • Рвота или диарея
  • Изменения в поведении
  • Чрезмерное слюнотечение
  • Отсутствие энергии или депрессия

Другие возможные признаки заболеваний печени включают темную мочу, бледные десны или скопление жидкости в брюшной полости, что может быть ошибочно принято за внезапное увеличение веса.Ваш ветеринар может назначить другие тесты для диагностики заболевания печени.

ВАЖНО: Признаки заболевания печени не очень специфичны, поэтому его трудно распознать. Если кошки с ожирением перестанут есть, могут возникнуть смертельные осложнения. Кошки, потерявшие аппетит на два-три дня, могут страдать кошачьим липидозом печени, состоянием, связанным с опасным накоплением жира в печени, которое нарушает ее нормальное функционирование. Если ваша кошка не ест, немедленно обратитесь к ветеринару.

Важность питания

Если вашей кошке поставлен диагноз, вам может быть интересно, как ухаживать за кошкой с заболеванием печени. Лечение любого заболевания печени направлено на отдых печени и минимизацию тех функций, которые связаны с метаболизмом жиров, белков, углеводов и лекарств. Когда у вашей кошки заболевание печени, еще более важно кормить ее правильным кормом. Кормите кошку легкоусвояемыми углеводами, высококачественными жирами и ограниченным количеством натрия, чтобы контролировать продолжающееся повреждение печени и улучшать ее функцию.

Для точного диагноза и вариантов лечения всегда консультируйтесь с ветеринаром и просите его порекомендовать лучший корм для здоровья печени вашей кошки.

Спросите своего ветеринара о заболевании печени:

  1. Какие продукты мне следует избегать из-за ее состояния?
    • Спросите, как человеческая пища может повлиять на здоровье вашей кошки.
  2. Вы бы порекомендовали корм для кошек Hill’s® Prescription Diet® для здоровья печени моей кошки?
    • Спросите об особенностях питания вашей кошки
    • Сколько / как часто вы должны кормить кошку рекомендуемым кормом
    • Обсудите, какими лакомствами можно кормить кошку с рекомендованным кормом
  3. Как быстро я должен увидеть признаки улучшения состояния моей кошки?
  4. Можете ли вы предоставить мне письменные инструкции или буклет о заболевании печени для моей кошки?
  5. Как лучше всего (по электронной почте/телефону) связаться с вами или с вашей больницей, если у меня возникнут вопросы?
    • Спросите, нужна ли вам повторная консультация.
    • Спросите, будет ли отправлено электронное письмо с напоминанием или уведомлением.

Вирусы | Бесплатный полнотекстовый | Новый гепаднавирус связан с хроническим гепатитом и гепатоцеллюлярной карциномой у кошек

1. Введение

Гепаднавирусы представляют собой семейство частично двухцепочечных ДНК-вирусов, обладающих узким кругом хозяев и сильным гепатотропизмом. Более 257 миллионов человек хронически инфицированы типовым видом вируса гепатита В (ВГВ) [1].Хроническая инфекция HBV может спровоцировать иммуноопосредованный хронический гепатит, который характеризуется некрозом, регенерацией и фиброзом, прогрессирующим до цирроза печени и гепатоцеллюлярной карциномы (ГЦК) [2]. Сложный патогенез HBV-ассоциированных гепатопатий и взаимодействие между вирусом и различными факторами риска остаются не до конца изученными [3]. Несмотря на эффективную вакцину против HBV, сохраняются серьезные проблемы с глобальным контролем HBV. В 2018 году был обнаружен новый природный гепаднавирус, гепаднавирус домашней кошки (DCH) [4].Инфекция DCH, по-видимому, распространена у кошек с виремией, обнаруженной у 6,5% и 10,8% домашних кошек в Австралии и Италии соответственно [4,5]. Потенциал DCH способствовать заболеванию печени кошек, если таковые имеются, еще не известен. Повышение вирусной нагрузки и уровня аланинаминотрансферазы (АЛТ) в сыворотке крови, биомаркеров прогрессирования HBV, у некоторых кошек, инфицированных DCH, косвенно подтверждает возможную роль DCH в заболевании печени кошек [5]. Хронический гепатит и ГЦК, потенциальные последствия HBV-инфекции у людей, также встречаются у домашних кошек, но считаются идиопатическими у этого вида [6].В этом международном многоцентровом исследовании мы использовали ПЦР и гибридизацию in situ (ISH) для выявления гепатотропизма, клеточных мишеней и распределения DCH в нормальных и больных образцах кошачьей печени.

2. Материалы и методы

2.1. Выбор случая и ткани
Образцы кошачьей печени, фиксированные формалином и залитые в парафин (FFPE), были получены из 4 учреждений в 4 странах (Калифорнийский университет в Дэвисе, США; Университет Сиднея, Австралия; Университет Мэсси, Новая Зеландия; Bridge Pathology). , Бристоль, Великобритания).Образцы были получены либо путем обычной биопсии, либо вскрытия, и все они были собраны с согласия владельца. Были отобраны случаи, которые представляли собой спектр часто диагностируемых заболеваний печени у кошек. Включение в исследование требовало наличия гистологических срезов, позволяющих подтвердить микроскопические признаки, соответствующие диагнозу. Слепой гистологический обзор проводился одним патологом (PP) для окончательной классификации. Случаи хронического (пограничного) гепатита были отобраны с использованием текущего международно принятого определения [7].В случаях, идентифицированных как холангит, воспаление четко сосредоточивалось на желчных протоках или вокруг них без воздействия или только с регионарным выпадением гепатоцитов. В случаях, классифицированных как ГЦК, наблюдалась потеря дольковой архитектуры, утолщение гепатоцеллюлярных тяжей, дольковая компрессия и/или инвазия и клеточная атипия от легкой до выраженной. Нормальный контроль печени определяли по отсутствию каких-либо гистологических признаков заболевания и нормальной концентрации АЛТ в сыворотке. Случаи и контроли были дополнительно отобраны на основе качества (отсутствие аутолитических изменений,
2.2. Экстракция ДНК

Срезы FFPE кошачьей печени толщиной 25 мкМ трижды депарафинизировали 1 мл ксилола и промывали 1 мл 100% этанола, 1 мл 90% этанола и 1 мл 70% этанола. Ткань расщепляли в течение ночи в 180 мкл буфера Qiagen ATL и 20 мкл раствора протеиназы К. ДНК очищали с использованием набора DNeasy Blood and Tissue (Qiagen, Hilden, Germany) в соответствии с инструкциями производителя и элюировали с использованием 100 мкл буфера для элюирования ДНК и хранили при -20 °C.

2.3. Традиционные анализы ПЦР
Для скрининга ДНК, выделенной из печени FFPE, на наличие DCH использовали два стандартных анализа ПЦР (кПЦР). Набор праймеров 1 (Hgap-F/Hgap-R) [4] амплифицирует участок вирусного генома размером 230 п.н., а набор праймеров 2 (FeHep.2116F (GCACCTGGATTCGCACAC)/FeHep.2371R (CCTTGAGGGAGTAAAGCCCTG)) амплифицирует участок 256 п.н. Фигура 1). 25 мкл реакционной смеси содержали 12,5 мкл HotStarTaq Plus Master Mix (Qiagen), 0,5 мкМ прямого праймера, 0,5 мкМ обратного праймера, 2,5 мкл красителя и 100–200 нг очищенной ДНК.Условия циклирования: начальный этап активации при 95 °C в течение 5 минут, затем 40 циклов при 94 °C в течение 30 с, 55 °C в течение 30 с (52 °C для набора праймеров 2) и 72 °C в течение 30 с. , с конечной стадией элонгации при 72 ° C в течение 10 мин. Ампликоны оценивали электрофорезом в 1,5% агарозном геле. Идентичность полос правильного размера подтверждали клонированием с использованием набора для клонирования TOPO TA (Invitrogen, Thermo Fisher Scientific, Уолтем, Массачусетс, США), секвенированием по Сэнгеру (центр для секвенирования ДНК, Калифорнийский университет в Дэвисе).
2.4. Гибридизация in situ
Мы разработали антисмысловой зонд V-FeHepadnavirus (Advanced Cell Diagnostics, Inc., Хейворд, Калифорния, США), нацеленный на область 604–1477 DCH, номер доступа Genbank Mh4079301 (рис. 1) [4]. Случаи, которые дали положительный результат на DCH с помощью cPCR и отрицательных контрольных тканей, были переведены в ISH. Колориметрический ISH выполняли вручную на срезах ткани FFPE размером 5 мкм на предметных стеклах Superfrost Plus (Fisher Scientific, Питтсбург, Пенсильвания, США) с использованием набора для анализа RNAscope 2.5 Red (Advanced Cell Diagnostics, Inc.). Каждый срез предварительно обрабатывали теплом и протеазой перед гибридизацией зонда в течение 2 ч при 40°С.

Для подтверждения сигнала использовались отрицательные контрольные зонды для зондирования серийных срезов, включая зонд, предназначенный для обнаружения дигидродипиколинатредуктазы (DapB) Escherichia coli (все случаи). Неинфицированная, гистологически нормальная ткань печени кошек использовалась в качестве отрицательного контроля ткани (n = 3). Предметные стекла были контрастно окрашены гематоксилином и смонтированы с помощью EcoMount (Biocare Medical, Concord, CA). Слайды были оцифрованы с использованием сканера Olympus VS120 и объектива 40× со светлопольным освещением.

2.5. Иммуногистохимия

Для ГЦР, связанного с DCH, индекс пролиферации определяли в двух репрезентативных случаях с помощью иммуногистохимии с использованием мышиного моноклонального антитела против Ki67, MIB1 (Agilent, DAKO, Санта-Клара, Калифорния, США). Выделение антигена проводили паром в течение 30 мин. Индекс пролиферации рассчитывали в 10 полях большого увеличения, каждое из которых содержало вирусоположительные и вирусоотрицательные участки, и представляли как процент Ki67-позитивных клеток по отношению к общему числу гепатоцитов.

4. Обсуждение

Гепаднавирусы, которые естественным образом инфицируют приматов, летучих мышей и грызунов, вызывают заболевания печени, включая хронический гепатит и ГЦК, но патогенез этих гепатопатий остается не до конца изученным [8,9]. Здесь впервые показано, что кошачий гепаднавирус связан с поражениями, отражающими патологии, вызванные HBV. Кроме того, в случаях, связанных с DCH, гистологические особенности воспаления и неоплазии, а также распределение вируса были поразительно сходны с теми, которые наблюдаются при заболевании, связанном с HBV.Несколько микроскопических признаков, которые соответствуют, но не патогномоничны для гепатита человека, ассоциированного с ВГВ, в том числе «частичный» некроз, апоптотические тельца и синусоидальное воспаление [10], были идентифицированы в комбинации в случаях хронического гепатита, связанного с ГВ, но не в DCH-негативный гепатит. Точно так же характер ГЦР, связанного с ГЦК, имеет общие черты с гепатопатиями, вызванными HBV и/или вирусом гепатита сурков, включая области вакуолярных изменений и отдельные гепатоцеллюлярные некрозы, хотя отдельные гистологические особенности ГЦК не позволяют отличить ГЦК-положительные от ГЦК-отрицательных случаев.Следует отметить большую пролиферацию гепатоцитов, наблюдаемую в областях ГЦК, связанных с ГЦК, по сравнению с вируснегативными областями, поскольку пролиферация гепатоцитов, вызванная иммунным ответом хозяина, способствует трансформации гепатоцитов в ГЦК, связанной с ВГВ [11]. Согласованность этого вывода теперь должна быть проверена на большем количестве ГЦК, связанных с DCH. HBV-ассоциированный HCC обычно возникает на фоне хронического воспаления и цирроза печени [12]. Хотя гистологический характер хронического гепатита, связанного с DCH и HBV, сходен, необходимы проспективные исследования, чтобы установить прогрессирование заболевания от воспаления до неоплазии.Во время репликации гепаднавирусы продуцируют внутриядерные формы ДНК, в том числе персистентную, ковалентно замкнутую кольцевую ДНК и интегрированный вирус, а также множественные цитоплазматические мРНК [13]. Антисмысловой зонд ISH, использованный в этом исследовании, предназначен для обнаружения РНК, но в случае двухцепочечных ДНК-вирусов зонд также обнаруживает смысловую цепь геномной ДНК. Паттерн гибридизации, выявленный в DCH-позитивных тканях, был регионально смешанным как по интенсивности, так и по внутриклеточному распределению (цитоплазматический, ядерный или оба).Этот паттерн согласуется со сложным жизненным циклом HBV и других гепаднавирусов [13]. Направленные геноспецифические зонды ISH могут помочь в дальнейшей разработке жизненного цикла DCH.

Анализ ISH для обнаружения DCH, разработанный и утвержденный здесь, расширяет возможности, доступные для обнаружения вирусов. Хотя и ПЦР, и ISH могут выявить инфекцию DCH, отрицательный результат любого теста не исключает инфекции. ISH более чувствителен, чем ПЦР, поскольку он может обнаруживать отдельные инфицированные DCH клетки, но для ISH берется лишь небольшое количество клеток, что может не отражать все патологические процессы в печени.Это может объяснить, почему только два из шести ПЦР-положительных случаев хронического гепатита были положительными для DCH на ISH, в отличие от всех PCR-положительных HCC. Если DCH-инфицированные клетки встречаются при гепатите реже, чем HCC, эти клетки могут быть не включены в биопсию. В качестве альтернативы результат ПЦР может отражать виремию, а не инфекцию гепатоцитов в четырех случаях ISH-отрицательного гепатита.

В совокупности результаты этого молекулярного и морфологического исследования демонстрируют убедительную связь между DCH и некоторыми случаями хронического гепатита и HCC.Сходство между присутствием и распределением вируса в этих поражениях у кошек и гепатопатиями у человека и сурка, вызванными HBV и WHV соответственно, позволяет предположить, что DCH может быть одной из причин хронического гепатита и HCC у кошек. Однако есть и другие объяснения нашим выводам. Обнаружение вируса в этих поражениях может быть совпадением или следствием заболевания, возможно, из-за локальной активизации репликации вируса.

Потенциальное влияние DCH на здоровье кошек будет представлять большой интерес для мирового ветеринарного сообщества из-за популярности кошек как животных-компаньонов человека [14].Хронический гепатит, по-видимому, редко встречается у кошек, частота его возникновения составляет 2,4% всех кошачьих биопсий печени [6]. По оценкам, первичная неоплазия печени составляет от 1% до 2,9% всех видов рака [15,16]. Билиарная карцинома и ГЦК встречаются с частотой 17% и 27% всех новообразований печени кошек [6]. В наших коллекциях из США и Великобритании за последние 10 лет ГЦК был наиболее частым первичным эпителиальным раком печени (ГЦК = 71/132, 54%). С другой стороны, в двух небольших исследованиях, проведенных на сегодняшний день, виремия DCH была обнаружена более чем у 10% кошек в зависимости от тестируемой популяции [4,5].Возможно, заболевание печени у кошек недооценивается, потому что ветеринарные диагностические исследования часто ограничены, а биопсия, особенно биопсия с помощью иглы, может не отражать патологические процессы во всей печени. Является ли инфекция DCH апатогенной или связана с субклиническим или клиническим заболеванием у кошек, еще предстоит определить. Проспективное клиническое исследование кошек с виремией DCH поможет понять влияние DCH на здоровье кошек. Если DCH будет идентифицирован как кошачий возбудитель, тогда можно будет исследовать потенциал обратной трансляции лечения и профилактики HBV для кошек.

Гепатит у кошек — причины, симптомы и лечение

Печень – один из самых больших органов в нашем теле, считается большой лабораторией и хранилищем организма. Он синтезирует множество ферментов и белков и, таким образом, является крупнейшим органом детоксикации . Печень также хранит гликоген, который необходим для баланса глюкозы, помимо других жизненно важных функций. Гепатит — это воспаление ткани печени и, следовательно, печени.

Хотя гепатит не так часто встречается у кошек , как у собак, вы всегда должны принимать его во внимание, когда сталкиваетесь с неспецифическими и общими симптомами, такими как потеря веса, анорексия, апатия и лихорадка, прежде чем ставить диагноз . Есть и более специфические симптомы, такие как желтуха.

Эта статья AnimalWised расскажет вам, как распознать гепатит у кошек , а также его причины, симптомы и лечение .

Что вызывает кошачий гепатит?

Воспаление печени может быть вызвано многими факторами; вот наиболее распространенные и частые причины :

  • Вирусный гепатит : Это не имеет абсолютно ничего общего с человеческим гепатитом.Это специфический кошачий вирус, который среди многих других симптомов может вызывать гепатит. Вирусы, вызывающие кошачий лейкоз и кошачий инфекционный перитонит, могут привести к гепатиту, поскольку вирусы разрушают ткань печени. Эти возбудители не только разрушают ткани печени, но и поражают другие органы кошачьего организма.
  • Бактериальный гепатит : Чаще встречается у собак, редко у кошек. Возбудитель – лептоспиры.
  • Паразитический гепатит : Часто вызывается токсоплазмозом (протозойным) или филяриозом (кровяной паразит).
  • Токсический гепатит : Вызывается попаданием в организм различных токсинов, также очень редко встречается у кошек из-за их пищевого поведения. Обычно из-за накопления меди в печени кошки.
  • Врожденный гепатит : также очень редко и обычно диагностируется случайно, при поиске других заболеваний. Возможны врожденные кисты печени.
  • Новообразования (опухоли): они чаще встречаются у пожилых кошек.Опухолевая ткань разрушает печень. Большую часть времени в печени нет первичных опухолей; вместо этого они появляются из-за метастазов опухолей в другие органы.

Каковы симптомы гепатита у кошек?

Гепатит обычно проявляет разные симптомы, в зависимости от того, является ли он острым или хроническим . Острая дисфункция печени обычно приводит к внезапному появлению симптомов.

Наиболее распространенным симптомом гепатита у кошек обычно является потеря аппетита и вялость .Накопление токсинов в организме влияет на нервную систему, и могут наблюдаться сопутствующие симптомы, известные как « печеночная энцефалопатия », включая изменения в поведении, ненормальные движения и даже судороги. Бездеятельность и депрессия являются обычным явлением.

Желтуха может быть еще одним симптомом. Это скорее специфический симптом заболевания печени, заключающийся в накоплении билирубина (желтого пигмента) в тканях. При хроническом гепатите наблюдается похудание и асцит (скопление брюшной жидкости).

Как лечить гепатит у кошек?

Лечение гепатита часто направлено на устранение причины, но в большинстве случаев его происхождение неизвестно — идиопатическое — или вызвано вирусами и опухолями. Вместо этого проводится симптоматическое лечение и диетотерапия .

Управление питанием означает изменение рациона кошки – создание дополнительной проблемы, поскольку это не так просто – путем корректировки его в соответствии с заболеванием. Он основан на снижении общего количества белка и повышении общего качества его рациона.

Эта статья носит чисто информативный характер. AnimalWised не имеет права назначать какое-либо ветеринарное лечение или ставить диагноз. Мы приглашаем вас отвезти вашего питомца к ветеринару, если он страдает каким-либо заболеванием или болью.

Если вы хотите прочитать статьи, похожие на Гепатит у кошек — причины, симптомы и лечение , мы рекомендуем вам посетить нашу категорию Другие проблемы со здоровьем.

Цирроз печени у кошек — заболевание печени кошек, вызывающее оранжевую мочу

Обзор
Цирроз — это хроническое заболевание печени на конечной стадии, при котором нормальная ткань печени заменяется фиброзной рубцовой тканью.Вашей кошке необходимо примерно 20% нормальной функции печени, чтобы выжить. При циррозе функционирующие клетки печени замещаются рубцовой тканью. Если нормальная функция печени падает ниже 20%, болезнь становится терминальной. Цирроз может возникнуть в любом возрасте, но чаще всего встречается у кошек старше 7 лет.

Цирроз печени возникает в результате поражения печени многими заболеваниями, лекарствами или токсинами. Общие заболевания, которые могут привести к циррозу, включают рак, а также вирусные, бактериальные и грибковые инфекции, вызывающие гепатит (воспаление печени).Некоторые токсины и длительное использование некоторых лекарств, таких как кортикостероиды и обычные обезболивающие, также могут вызывать цирроз печени. Поэтому крайне важно контролировать функцию печени вашей кошки, когда она принимает определенные лекарства.

Симптомы
Симптомы зависят от причины цирроза печени и могут включать:

  • Потеря аппетита; потеря веса
  • Рвота
  • Диарея или запор
  • Недостаток энергии; депрессия
  • Повышенная жажда; мочеиспускание
  • Вздутие живота (заполненное жидкостью)
  • Оранжевый оттенок мочи
  • Желтый оттенок десен и белков (склер) или слизистой оболочки глаз (желтуха)
  • Проблемы с кровотечением
  • Изменения в поведении; судороги; хождение по кругу
  • Болезненный живот
  • Отсутствие координации

Диагностика/лечение
Ваш ветеринар соберет полный анамнез и проведет тщательный медицинский осмотр вашего питомца.Кроме того, потребуются диагностические тесты, чтобы определить, есть ли у вашей кошки цирроз печени. Сюда могут входить:

  • Химические тесты для оценки функции почек, печени и поджелудочной железы, а также уровня сахара
  • Серологические тесты для определения того, был ли ваш питомец подвержен инфекционным заболеваниям
  • Общий анализ крови (CBC) для подтверждения при определенных состояниях, связанных с кровью
  • Электролитные тесты, чтобы убедиться, что ваш питомец не обезвожен или не страдает электролитным дисбалансом
  • Анализы мочи для выявления инфекций мочевыводящих путей и других заболеваний
  • Анализ щитовидной железы, чтобы определить, функционирует ли щитовидная железа обычно
  • Рентгенологическое исследование для оценки размера, формы и положения печени
  • УЗИ органов брюшной полости для оценки печени и других жизненно важных органов
  • Профили коагуляции для оценки свертывающей функции вашего питомца
  • Биопсия печени

Лечение для вашей кошки будет варьироваться в зависимости от основной причины повреждения печени и цирроза.Хорошая новость заключается в том, что лечение основной причины цирроза во многих случаях может остановить прогрессирование повреждения.

Лечение может включать следующее:

  • Прекращение любой терапии, которая могла вызвать повреждение печени
  • Внутривенная инфузионная и электролитная терапия, если у вашего питомца обезвоживание
  • Препараты крови, если у вашего питомца анемия
  • Диетические изменения
  • Лекарства, в зависимости от причины

Профилактика
Прогноз для вашей кошки зависит от двух факторов: степени нарушения функции печени и способности лечить и контролировать основную причину.Наиболее эффективной профилактикой цирроза печени является как можно более раннее лечение заболевания печени и поддержание профилактического медицинского обслуживания вашей кошки, чтобы избежать любой ситуации, которая может вызвать заболевание печени.

Если у вас есть какие-либо вопросы или опасения, вы всегда должны посетить или позвонить своему ветеринару — это ваш лучший ресурс для обеспечения здоровья и благополучия ваших питомцев.

Заболевания печени и их лечение у собак и кошек (Proceedings)

Диагностика и лечение заболеваний печени у собак и кошек значительно улучшились за последние 20 лет благодаря тому, что клиницисты работают над постановкой окончательного диагноза с помощью усовершенствованных диагностических процедур.Знания, накопленные в течение многих лет благодаря более точным диагнозам, позволили разделить клинические заболевания на категории инфекционных, воспалительных, иммуноопосредованных, неопластических, алиментарных и токсических заболеваний печени. Лечение, направленное на конкретное заболевание, улучшило исход у наших пациентов. Диагностические процедуры для более точной диагностики заболеваний печени включают в себя результаты физического осмотра, клиническую патологию, рентгенологию, сцинтиграфию, УЗИ брюшной полости (УЗИ), тонкоигольную аспирацию под контролем УЗИ и биопсию тканей, а также лапароскопию, диагностическую целиотомию и биопсию тканей.Лечение является наиболее успешным, если можно устранить основную причину, однако поддерживающая терапия осложнений заболевания печени и гепатоэнцефалопатии также может иметь большое значение по мере заживления печени.

Клинические признаки заболевания печени

Пациенты часто имеют неспецифические признаки заболевания печени со снижением аппетита, анорексией, вялостью, потерей веса, периодической рвотой/диареей и ЯБ/БП. Более специфичными признаками заболевания печени являются желтуха и асцит с пониженным содержанием белка.Некоторые пациенты имеют хронический анамнез, в то время как другие имеют острый анамнез в зависимости от основного заболевания и от того, поражено ли более 80% печени и не функционирует ли она должным образом. Хотя клинические признаки могут присутствовать до того, как это произойдет, у большинства пациентов признаки клинического заболевания проявляются уже на этой стадии.

Бактериальные заболевания печени

Бактериальные заболевания печени обычно вызываются восходящими инфекциями из желудочно-кишечного тракта через воротную вену или желчные протоки.Печеночная артерия также может доставлять в печень системные бактерии, такие как лептоспироз. Грамположительные, грамотрицательные и анаэробные бактерии являются нормальной флорой печени и могут вызывать инфекционные заболевания, когда печень поражается бактериями из желудочно-кишечного тракта или печень подвергается серьезному поражению каким-либо образом, например, токсином. Кошачий гнойный холангит/холангиогепатит в первой фазе комплекса, собачий холангит/холангиогепатит, абсцессы печени, токсоплазмоз и лептоспироз являются наиболее распространенными проявлениями бактериального заболевания печени.

Лечение

Идеально провести биопсию печени для посева ткани на специфические бактерии и чувствительность к антибиотикам. Должны быть представлены аэробные и анаэробные культуры. Антибиотики могут быть подобраны эмпирически на основании известной бактериальной флоры печени. Ампилицин, цефалоспорины, энрофлоксацин, метронидазол (низкая доза 7 мг/кг), а также клиндамицин и хлорамфеникол являются хорошим выбором в комбинации для охвата широкого спектра бактерий.

Воспалительные заболевания печени

Негнойный холангиогепатит кошек во второй фазе комплекса, хронический активный гепатит (ХАГ) у собак, гепатотоксичность меди у собак и, возможно, гранулематозное заболевание печени являются наиболее распространенными диагнозами воспалительного заболевания печени.Диагноз с помощью биопсии ткани необходим для выявления присутствующих воспалительных клеток. Культура тканей печени также необходима для устранения бактериального заболевания как компонента.

Лечение

Противовоспалительные средства: преднизолон, азатиоприн (Имуран®), циклоспорин (Атопика®) и хлорамбуцил. Было показано, что антиоксиданты улучшают хроническое повреждение гепатоцитов, которое вызывает окислительное повреждение. Доказано, что витамин Е (альфа-токоферол) эффективен у людей с хроническим гепатитом, а также подозревается, что он полезен для собак и кошек.Также было показано, что расторопша пятнистая (силимарин) и S-аденозилметионин (денозил SD4) защищают печень от повреждений, вызванных токсинами и гепатопатией, вызванной кортикостероидами. Денозил обеспечивает гепатоцит глутамином, который необходим для метаболических реакций в гепатоците для поддержания функции печени. Антифибротики могут предотвратить отложение коллагена во время воспаления и стимулировать активность коллагеназы для предотвращения цирроза печени, который является конечной стадией воспаления печени и является необратимым.Для этой цели часто используется колхицин, однако его эффективность у собак не изучалась. Холертики, такие как урсодезоксихолевая кислота (Actigall®), заменяют «плохие» желчные кислоты (гидрофильные) «хорошими» желчными кислотами (гидрофобными) в кишечнике, так что «плохие» желчные кислоты не вызывают повреждения гепатоцитов во время холестаза. Есть клинические отчеты о собаках, которые показывают улучшение ферментов печени и гистопатологию при его использовании.

Гепатотоксичность меди у собак

Гепатотоксичность меди у собак может быть первичным или вторичным заболеванием.Накопление меди происходит в гепатоците из-за повреждения механизма, высвобождающего медь из клетки. Первичная гепатотоксичность меди чаще наблюдается у бедлингтон-терьеров, белых хайленд-уайт-терьеров, скай-терьеров и доберман-пинчеров, однако первичное заболевание может быть у любой породы. Вторичная гепатотоксичность меди возникает вторично по отношению к воспалению в печени. Хронический активный гепатит, особенно у собак, может вызвать повышенное накопление меди в печени, вторичное по отношению к основной причине воспаления.Если не распознать это заболевание, это может привести к дальнейшему повреждению гепатоцита. При диагностике заболевания печени у собаки с помощью биопсии ткани следует провести количественную оценку содержания меди в ткани печени. Кусочек ткани печени помещают в стерильную пробирку с красной крышкой и отправляют на ночь в охлаждаемом пакете в указанную лабораторию, которая проводит эти измерения. Нормальный уровень меди в тканях составляет менее 400 мкг/г сухого веса. Пациентам с уровнем меди выше 750 мкг/г сухого веса следует проводить терапию по снижению содержания меди.Терапия включает диету с низким содержанием меди, такую ​​как диета Hill’s Science L/D. Наиболее важной является терапия для удаления меди из печени. Цинк эффективно снижает всасывание меди в желудочно-кишечном тракте за счет увеличения синтеза металлотионина, с которым медь связывается и выделяется с эпителиальными клетками. При умеренном повышении уровня меди это хороший вариант лечения, однако он медленно снижает уровень меди, и может потребоваться до 3-6 месяцев, чтобы снизить уровень в тканях ниже 400 мкг/г. Иногда наблюдаются побочные эффекты в виде рвоты и возможна гемолитическая анемия, хотя и редко.Терапия хелаторами меди намного эффективнее снижает уровень меди в тканях за счет удаления меди из гепатоцитов. При уровне меди выше 2000 мкг/г следует использовать хелатор меди для более быстрого снижения уровня меди. D-пеницилламин (купрамин) увеличивал синтез металлотионина в печени, снижая уровень меди на 900 мкг/г в год. Побочные эффекты рвоты и анорексии являются общими и иногда ограничивают его использование. Триентин (сиприн) – 2,2,2, тетрамин может связывать медь в сыворотке и ткани печени по тому же механизму, что и D-пеницилламин, и с той же скоростью 900 мкг/г в год восстанавливает медь в печени.Этот препарат может быть трудно найти. 2,3,2 Тетрамин является превосходным хелатором меди у бедлингтон-терьеров, которые могут быть устойчивыми к препаратам, снижающим концентрацию меди. Для всех больных он в 4-9 раз более эффективен, чем другие энтеросорбенты, со снижением содержания меди в печени на 3000 мкг/г в год. О побочных эффектах ни для одного из препаратов не сообщается.

Липидоз печени кошек

Липидоз печени кошек — это синдром неизвестной этиологии, однако в анамнезе у кошек периоды голодания в течение 1-2 недель во время посадки или другой стресс часто предшествуют заболеванию.Другие проблемы, такие как калагниогепатит, сахарный диабет или гипертиреоз, могут сопровождаться периодами анорексии, которые могут вызвать вторичный липидоз печени. Для этого расстройства нет определенной возрастной, породной или половой предрасположенности. Кошка редко страдает этим расстройством дважды в своей жизни, хотя случаи были зарегистрированы. Кошки в возрасте до 2 лет имеют лучший прогноз на выздоровление, хотя многие кошки старшего возраста успешно преодолевают этот синдром при своевременном и правильном лечении.Известными механизмами, происходящими в гепатоцитах и ​​вызывающими накопление жира внутри клетки, являются дефициты важных белков, которые выводят жирные кислоты из клетки, называемых апопротеинами. Что инициирует этот процесс, неизвестно. Диагноз включает клиническое подозрение в анамнезе, клинические признаки печеночной недостаточности с часто наблюдаемой желтухой. Обнаружение при физикальном осмотре увеличенной печени. Тучные кошки могут быть предрасположены к этому синдрому. Клиническая патология, поддерживающая печеночную недостаточность, должна сопровождаться повышением ЩФ, АЛТ, АСТ и наиболее часто обнаруживаемой гипербилирубинемией.Ультразвуковое исследование брюшной полости печени может показать очень гиперэхогенную печень, а аспирация тонкой иглой может подтвердить наличие гепатоцитов с жировыми вакуолями по всей цитоплазме при цитологии. Лапароскопическая или хирургическая биопсия необходима для исключения первичных причин заболеваний печени, которые могут иметь вторичный печеночный липидоз. Лечение должно быть начато на ранней стадии с агрессивной нутритивной поддержки, проводимой через зонд для энтерального питания (эзофагостомический или гастротомический (ПЭГ) зонд), чтобы обеспечить адекватное питание, включая диету с высоким содержанием белка и достаточное количество калорий.Принудительного кормления и стимуляторов аппетита недостаточно для лечения этого заболевания, потому что эти кошки страдают анорексией и не могут получать достаточное количество пищи для адекватного лечения. Показаны рационы с высокой калорийностью и содержанием белка выше 46% сухого вещества. Хорошим выбором является диета Hill’s Science P/D или A/D или другие эквивалентные диеты. Сообщается, что добавка L-карнитина быстрее улучшает клинические признаки. Витамин Е и витамин К также показаны для уменьшения гепатопатии и коагулопатии соответственно.

Комплекс кошачьего холангиогепатита

Комплекс кошачьего холангиогепатита состоит из процесса, который происходит в печени с течением времени. Первоначально считается, что возникает бактериальная инфекция (фаза нагноения), а затем бактериальная инфекция исчезает, но вызывает иммунно-опосредованный ответ (лимфоцитарно-плазмоцитарная фаза), который является хроническим заболеванием. В более тяжелых случаях может развиться билиарный цирроз, который не поддается лечению. Нагноительные заболевания лечат антибиотиками широкого спектра действия, чтобы воздействовать на грамположительные/грамотрицательные/анаэробные бактерии.Амоксициллин и метронидазол (сниженная доза 7 мг/кг) являются хорошим выбором для эмпирического лечения. Биопсия печени показана для диагностики лимфоцитарно-плазмоцитарного заболевания с показанием противовоспалительных/иммуносупрессивных средств, таких как преднизолон, хлорамбуцил и циклоспорин. Эти пациенты с правильно поставленным диагнозом могут чувствовать себя хорошо при регулярном наблюдении и изменении лечения по мере необходимости. Следует исключить другие заболевания печени у кошек, такие как инфекционный перитонит, токсоплазмоз и лимфосаркома.

Лечение заболеваний печени у собак и кошек

Лечение заболеваний печени у собак и кошек варьируется от специфической терапии, направленной на устранение последствий известной этиологии заболевания печени, до поддерживающей терапии пациента во время печень со временем восстанавливается, например, в случае токсичности печени.Кроме того, могут возникать вторичные эффекты печеночной недостаточности, такие как коагулопатия, гепатоэнцефалопатия, рвота, электролитный и кислотно-щелочной дефицит, судороги, портальная гипертензия и асцит.

Жировая болезнь печени у кошек

Липидоз печени кошек, также называемый жировой болезнью печени, представляет собой аномальное накопление жира (обычно триглицеридов) в печени кошки. Это наиболее распространенное заболевание печени, диагностируемое у кошек в Северной Америке. Все, что вызывает значительное снижение потребления пищи, может привести к этому состоянию.Ожирение является известным фактором риска, и чаще всего страдают от ожирения взрослые кошки среднего возраста; однако он может развиться у любой кошки, которая не ела в течение определенного периода времени. Ни одна порода или пол не предрасположены к этому заболеванию.

Причины жировой болезни печени кошек

Жировая болезнь печени у кошек может возникать без очевидной причины или может возникать вторично по отношению к определенным заболеваниям. Обычно это происходит у кошек, которые не ели в течение нескольких дней. Заболевания, связанные со вторичным липидозом печени, включают сахарный диабет, панкреатит (воспаление поджелудочной железы), диабетический кетоацидоз (тяжелое состояние, вызванное нелеченым или неконтролируемым диабетом), воспалительное заболевание кишечника, холангит (воспаление желчного пузыря), гепатит (воспаление поджелудочной железы). печень) и рак.

Точная физиология этого заболевания до конца не изучена. Некоторые кошки предрасположены к этому из-за более высокого содержания жира в их диетах, основанных на белке, их высокого соотношения внутреннего жира и подкожного жира и других аспектов, характерных для кошачьего метаболизма.

Клинические признаки липидоза печени кошек

Многие больные кошки не едят в течение нескольких дней. Период, в течение которого кошка страдает анорексией (не ест), может составлять всего два дня.Обычно происходит последующая и быстрая потеря веса — от 40 до 60 процентов массы тела. Клинические признаки включают психическую депрессию, слабость, обезвоживание, рвоту, диарею и запор. Желтуха (пожелтение кожи и слизистых оболочек) отмечается у большинства кошек с этим заболеванием, а в результате тошноты и рвоты может наблюдаться слюнотечение.

Диагностика

Жировая болезнь печени кошек диагностируется на основании физического осмотра, клинических признаков и изменений ферментов печени, а также других показателей, наблюдаемых при лабораторных исследованиях.Печень обычно увеличена на рентгенограммах, а на УЗИ печени имеется характерный вид, который помогает подтвердить диагноз. Иногда может возникнуть необходимость дифференцировать липидоз печени от другого заболевания, такого как рак, и требуется тонкоигольная биопсия или более крупная биопсия печени кошки.

Лечение и диета при жировой болезни печени кошек

Одним из важнейших компонентов лечения жировой болезни печени является нутритивная поддержка.Недостаток питания позволяет продолжить аномальный метаболический цикл (накопление жира в печени). В прошлом иногда применялся тип «принудительного кормления», подразумевающий использование шприца для нагнетания разжиженной пищи в рот кошки. Этот метод обычно не рекомендуется сегодня и может привести к отвращению к еде.

Для нутритивной поддержки большинству кошек требуется введение зонда для кормления. Существуют различные способы введения зондов для кормления: некоторые из них можно вводить через нос в пищевод или желудок, а некоторые — напрямую через кожу шеи в пищевод.В Best Friends мы предпочитаем использовать последний метод для более длительного кормления при лечении липидоза печени. Трубка ставится, пока кошка находится под наркозом; большинство кошек хорошо переносят трубку.

Ветеринарная диета для восстановления или интенсивной терапии по рецепту вводится через зонд от четырех до шести раз в день. Кормление через зонд начинают постепенно, а количество корма увеличивают в течение нескольких дней, чтобы желудок кошки мог вместить объем пищи и избежать метаболического дисбаланса, который может возникнуть при повторном введении пищи.

Кошке также начинают внутривенное введение жидкости для коррекции обезвоживания и восполнения потери жидкости из-за рвоты или диареи. Если кошку тошнит или ее продолжает тошнить, могут потребоваться противорвотные (противорвотные) препараты. Кроме того, кошке может понадобиться витамин B12 и другие витамины группы B, а также добавки с калием. Поскольку печень вырабатывает факторы свертывания крови, у некоторых кошек могут быть проблемы со свертываемостью крови, поэтому это может потребоваться проверить и контролировать (особенно перед выполнением такой процедуры, как биопсия).

Прогноз для кошек с заболеванием

Кошкам с липидозом печени сначала потребуется госпитализация. Необходимо устранить рвоту и обезвоживание, а также контролировать уровень электролитов в организме кошки, чтобы убедиться, что любой дисбаланс корректируется надлежащим образом. Как только кошка хорошо перенесет кормление через зонд, ее можно выписать из больницы, чтобы свести к минимуму стресс. Кормление через зонд может осуществляться дома или у приемного человека. Трубку обычно оставляют на месте до тех пор, пока кошка не начнет постоянно потреблять достаточное количество ежедневных калорий самостоятельно (без введения кормления через трубку).

Прогноз для кошек с жировой болезнью печени варьируется; это зависит от того, присутствуют ли основные расстройства и можно ли их эффективно лечить. Некоторые сопутствующие заболевания ухудшают прогноз; например, кошки с липидозом печени, вторичным по отношению к острому тяжелому панкреатиту, имеют значительно более осторожный прогноз. Агрессивная медицинская диагностика и лечение очень важны, и хорошая новость заключается в том, что многие кошки выздоравливают при соответствующей терапии.

Рекомендации по поддержанию здоровья вашей кошки

.

Добавить комментарий

Ваш адрес email не будет опубликован.