Содержание

Веселый Гном | Стандарт и комментарии

Ниже приведён действующий стандарт FCI, некоторые пункты которого  я , будучи судьёй и заводчиком с многолетним стажем,  позволю себе прокомментировать с учётом современного взгляда на породу , который сформировался у меня и у моих коллег- судей и заводчиков шпицев из  Франции,  Швеции, Германии, Польши и других стран FCI.  Мои комментарии выделены красным цветом.

 

При копировании материала и размещении его в интернете, прошу ссылаться на сайт.

Благодарю Ольгу Певунову за профессиональную помощь в переводе стандарта.

 

СТАНДАРТ ФЦИ № 97 

 

от 25.01.2013 

 

Немецкий шпиц, включая кеесхонд и помераниан

 

Страна происхождения: Германия.

Использование: охранная собака и собака-компаньон.

Группа FCI 5: шпицы и примитивные собаки(без рабочих испытаний).

Краткая историческая справка: Немецкие шпицы являются потомками жившей в каменном веке «торфяной собаки» и представляют собой самую древнюю породу собак Центральной Европы. Они стали прародителями многих других пород. В не немецкоязычных странах вольфшпицы называются также кеесхондами, а цвергшпицы-померанцами.

Комментарий: Кеесхонды (порода получила это название в начале 20-х годов прошлого столетия в Голландии) и вольфшпицы довольно долго развивались обособленно друг от друга, но так как они несомненно имеют общее происхождение, последний стандарт FCI объединил их в одну породу. Название «померанский шпиц» или «померанец», принятое в Англии, где впервые началась миниатюризация породы, Америке и некоторых других странах, произошло от названия Померании -одной из областей Германии.

Поведение и характер: Немецкий шпиц постоянно во внимании, живой и необычайно привязанный к своему владельцу. Он очень понятливый и легко обучается. Его недоверчивость к посторонним и отсутствие у него охотничьего инстинкта, делают его идеальным охранником дома и двора. Он не боязлив и не агрессивен. Устойчивость к непогоде, прекрасное здоровье и долголетие являются его выдающимися качествами.

 

Общее впечатление: Шпицы подкупают своей прекрасной, стоячей (из-за богатого подшерстка) шерстью. Особенно впечатляет роскошный воротник вокруг шеи и очень пушистый хвост, который шпиц задорно несет на спине. Похожая на лисью голова с юркими глазками, острые, маленькие, близко поставленные стоячие уши придают шпицу характерный задорный вид.

Важнейшие пропорции:

Высота в холке: косая длина туловища= 1 :1

 

Голова: Череп средней величины. Голова при взгляде сверху клинообразно сужается к мочке носа. Стоп хорошо выражен, не резкий.

Обращаю Ваше внимание на последнее предложение. Вполне логично , что в зависимости от размера ( от кеесхонда до померанца) , стоп становится всё более выраженным и достаточно хорошо выражен у померанцев. С прилитием в породу собак американского и канадского разведения, стоп, особенно у померанцев, стал более резко выражен, я не считаю это серьёзным недостатком современного миниатюрного шпица, за исключением тех случаев, когда шпиц с излишне выраженным резким стопом теряет своё типичное выражение.  Предпочтения в типах головы конечно яляется прерогативой заводчиков и судей, но я думаю, что малый шпиц не должен быть увеличенной копией померанца и имеет право на свой неповторимый облик.

Круглый череп, равно как и плоский, является недостатком , который наказывается, в зависимости от степени выраженности .

Морда: не слишком длинная, не грубая, но и не заостренная, находится в гармоничной пропорции с черепом ( у вольфшпицев, больших и средних шпицев — соотношение длины морды к длине черепа приблизительно 2:3, у малого и миниатюрного шпица-2:4).

 Особи с утрированно короткими и слишком объемными мордами ( этот признак  часто сочетается с тяжелым костяком)  в породе крайне нежелательны.

Мочка носа: круглая, маленькая, всегда черная (у коричневых — в тон окраса).

Мочка носа может чуть осветляться у оранжевых собак в зимний период, иногда во время линьки,  у старых собак и у собак светло-кремового окраса ( у кремовых собак мочка всегда светлее, чем у собак других окрасов),   в остальных случаях , кроме  коричневых собак, мочка должна быть чёрной.

Губы: плотно прилегают и не образуют складок в углах пасти. Пигментация-всегда черная (у коричневых — в тон окраса).

Челюсти и зубы: челюсти нормально развиты и имеют ножницеобразный прикус с 42 зубами (у цвергшпица/померанского и малого шпица допускается отсутствие некоторых премоляров). Клещеобразный прикус допустим у всех разновидностей шпицев.

По положению немецкого Шпицклуба не снижается оценка ( это касается цвершпицев и малых) за отсутствие не более 3-х премоляров из всего набора первых и вторых. Это внутреннее положение Германии, но не требование стандарта, поэтому  наказание собаки за отсутсвие P3 или P4  — прерогатива судьи.  Я считаю  что оценка собаки, с большим количеством отсутстующих премоляров,  должна быть снижена.


Незначительная «нелинейка», когда некоторые резцы могут чуть (не более, чем на толщину зуба) выступать за линию правильной дуги, допускается.

Надеюсь понятно, что стандарт требует полного набора резцов, т.е. 6 х 6 .

 

Скулы: мягко округленные, не выступающие.

Глаза: среднего размера, миндалевидные, чуть косо поставлены, темного цвета. Веки с черной пигментацией у всех окрасов (у коричневых шпицев – в тон окраса).

 

К недостаткам следует отнести слишком крупные и круглые глаза,  выпуклые, а также текущие глаза, в случае сильно выраженных подтеков, собака должна наказываться снижением оценки или, в особо тяжёлых случаях -дисквалификацией ( см.  пункты о дисквалификации -энтропия и эктропия).

Уши: маленькие, посажены высоко и относительно близко друг к другу, треугольные, остростоячие с жесткими кончиками.

Типичные недостатки — низковато посаженные уши,   широко посаженные уши(при излишне широкой черепной части), крупноватые уши. Гораздо реже втречаются такой недостаток,  как округлые кончики ушей, но мода на грумминг диктует именно такую форму, поэтому самый верный способ определения истинной формы ушей, это мануальный осмотр.

 

Шея: средней длины, в плечах широкая, слегка выгнутая в загривке, без подвеса, покрыта обильной шерстью в виде гривы.

Корпус:

Линия верха: начинается с кончиков стоячих ушей и плавной дугой переходит в короткую прямую спину.

Холка/спина : Высокая холка незаметно переходит в как можно более короткую,крепкую, прямую спину.

Хотя анатомически правильный шпиц выглядит высокоперёдым, за счёт выгнутой в загривке шеи и густой гривы, следует понимать, что шпиц не  имеет ниспадающую линию верха и этот признак не следует считать желательным, т.к. высокоперёдость шпица, как правило, обусловлена слишком развёрнутым углом плече-лопаточного сочленения.

 

Поясница: короткая, широкая.

 

Круп: широкий и короткий, не скошенный.

Грудь: глубокая, с хорошим сводом, хорошо развит форбруст.

Линия низа: грудная клетка как можно более длинная, живот умеренно подтянут.

Хвост: высоко посажен, средней длины, от корня сразу же поднимается вверх, закинут вперед и на спину, плотным кольцом прилегает к спине, очень пушистый. Допускается двойное кольцо на кончике хвоста.

Передние конечности:

Общее впечатление: прямой, широкий фронт.

Плечи: с хорошей мускулатурой, плотно прилегают к грудной клетке. Лопатки длинные и косо направлены назад, почти такой же длины плечо образует с лопаткой угол прибл. 90 градусов.

Локти:

локтевой сустав крепкий, локти прилегают к грудной клетке, не вывернуты ни наружу, ни внутрь.

Предплечья: средней длины, крепкие, совершенно прямые, с хорошими очесами на задней стороне.

Пясти : крепкие, средней длины, образуют с вертикалью угол 20 градусов.

Передние лапы: по возможности маленькие, круглые, собранные, т.н. «кошачьи лапы». Когти и подушечки чёрные, темно-коричневые у всех коричневых шпицев.

 

Задние конечности:

Общее впечатление : Задние конечности очень мускулистые, роскошные штаны до скакательных суставов. Задние конечности прямые, параллельны друг другу.

Бедро/Голень : Бедро и голень приблизительно равны по длине.

Колено : Коленный сустав крепкий, угол умеренный, в движении не выносится ни наружу, ни внутрь.

Плюсна : Плюсна средней длины, очень крепкая, ставится вертикально к земле.

Задние лапы : Лапы на задних конечностях по возможности маленькие, круглые, пальцы хорошо прилегают друг другу, сводистые, т.н. кошачьи лапы, подушечки плотные. Цвет подушечек и когтей возможно более темный.

Движения: Движения немецких шпицев с хорошим толчком, по прямой, свободные и пружинистые.

Кожа: Туго прилегает к телу, не образуя складок.

 

Шерстный покров:

Шерсть: шерстный покров двойной-длинный, прямой, отстоящий покровный волос

и короткий, густой подшерсток. Голова, уши, передняя сторона передних и задних конечностей, лапы покрыты короткой и плотной шерстью, остальные части тела покрыты длинной и богатой шерстью; не волнистой, не курчавой, не образующий на спине пробора. На шее и плечах густая грива. На задней стороне передних конечностей очесы. Задние конечности от крупа до скакательных суставов имеют роскошные штаны, хвост обильно опушен.

К очень серъёзному недостатку можно отнести, так называемую «ватную» шерсть, которая к сожалению стала встречаться у померанцев,  при этом излишне развит подшёрсток ( слишком густой и длинный) и редкая остевая шерсть.  В этом случае  разница между остевой шерстью и подшёрстком практически неразличима.  На ощупь такая шерсть кажеться -сухой и «ватной», тогда как правильная шерсть шпица на ощупь шелковистая и упругая, но она не должна быть  лёгкой и тонкой   или наоборот тяжёлой .

 

Окрас: 

Вольфшпиц: волчий(Grey shaded -серый с чернью)

Большой шпиц: черный, коричневый, белый.

Средний, малый и миниатюрный шпиц: черный, коричневый, белый, оранжевый, волчий и другие окрасы.

Черный окрас: однотонный глубокий черный без белых пятен или иных оттенков.

 

Часто у молодых собак черного окраса наблюдается возрастной «перецвет» — седина на штанах и на воротнике, что проходит с возрастом, когда шерсть собаки окончательно поменяется на «взрослую»,  правда  лёгкая седина на штанах чаще наблюдается у взрослых помераских шпицев , что неизбежно при вязках собак черного окраса с нечерными,  к тому же окрас подшёрстка иногда имеет сероватый оттенок. Это часто наблюдается в других породах, например у чёрных чау-чау,  и не является  недостатком в отличие от очевидных  сероватых и рыжеватых зон на остевом волосе , что нужно отнести к  серьезному недостатку или к пороку ( в зависимости от степени выраженности). Так называемая «ранняя седина» на морде встречается у шпицев разных окрасов и не является недостатком.

Коричневый окрас: равномерно-однотонный, темно-коричневый.

Белый окрас: чисто белый, без каких-либо оттенков.

Оранжевый окрас: равномерно-однотонный цвет в средней шкале цветовой гаммы.

Волчий : серебристо-серый с черными кончиками волос, на морде и ушах шерсть темная, вокруг глаз отчетливый рисунок из тонкой черной линии, проходящей по косой от наружного угла глаза до нижнего основания уха, грива и воротник на плечах светлые, черный кончик хвоста, нижний кончик хвоста и штаны светло-серебристого цвета.

 

Хочу добавить несколько слов о некоторых возможных различиях волчьего окраса у кеесхондов и у других разновидностей шпицев( среднего, малого и миниатюрного).  Дело в том, что только у кеесхондов(вольфшпицев), которые разводятся «в себе» закреплён  единственный для вольфшпицев стандартный волчий окрас ,  разведение же более мелких разновидностей шпицев  не велось изолированно( в родословных таких собак, кроме волчьего ,  встречаются и другие окрасы) ,  поэтому  их   волчий окрас вариирует от светло-серого с чернью до очень тёмного, маска может быть осветлённой , характерный рисунок вокруг глаз , как правило сохраняется .  Думаю судьям следует учитывать эту ситуацию и относится с понимание к интесивности вольчего окраса у миниатюрных и малых шпицев. В родословных разных стран волчий окрас записан , как «volf» или» volf-sable» или «silver-sable».

Несколько примеров волчьего  окраса у  малых  и цвергшпицев-



классический стандартный окрас кеесхонда

Другие окрасы: под термином «другие окрасы» понимают такие, как: кремовый, кремово-соболиный, оранжево-соболиный, черно-подпалый, пятнистый. Основной фон пятнистых собак – белый. Черные, коричневые, серые или оранжевые цветовые пятна распределяются по всему корпусу.

Ещё раз подчеркну, что основной тон пятнистых собак-белый ( чисто белый, без крапа). Визуально собака должна выгдядеть белой с пятнами, а не наоборот, при этом предпочтение следует отдавать собакам, когда белый цвет на голове присутствует в виде  симметричной проточины (это желательный признак, но не обязательный)  и цветные пятна равномерно рас пределенны по корпусу.  В стандарте не оговорено расположение пятен, но во всех породах всегда существуют негласные предпочтения.  Конечно из этого не следует, что несимметричный рисунок  на голове или чисто белый окрас головы являются недостатками.  Цвета пятен обозначены в стандарте, при этом  шпиц имеет две модификации оранжевого окраса : чисто оранжевый и оранжево-соболиный , а серый окрас существует только в виде волчьего , поэтому пятна, кроме чёрных и коричневых,  могут быть, как оранжевыми , так и оранжево-соболиными и волчьими( серыми с чернью).

Недостатками  окраса  являются :  плащевой окрас, излишне «забелённый» окрас, при котором цветные зоны практически отсутствуют (например- пятно только вокруг глаза ( монокль) или  на  ухе ,  или одно-два небольших пятна на корпусе), хотя я считаю, что слишком забелённые собаки должны наказываться гораздо в меньшей степени, чем те,  у которых зоны депигментации очень мало выражены и при которых собака по сути является не белой с пятнами, а черной ( оранжевой, коричневой или серебристо-соболиной ) с белыми пятнами, что является по сути порочным окрасом. К недостаткам пятнистого окраса следует отнести и крап, если он слабо выражен на лапах и морде. Если же у собаки большие крапчатые зоны  на  лапах, корпусе  и морде , это  также должно строго наказываться.

Примеры желательного пятнистого окраса —


плащевой окрас (недостаток пятнистого окраса)

Размеры:

Высота в холке:

Вольфшпиц / Кеесхонд 49 см + — 6 см

Большой шпиц 46см + — 4 см

Средний шпиц 34 см + — 4 см

Малый шпиц 26 см + — 3 см

Цвергшпиц /Помераниан 20 см + — 2 см (экземпляры ниже 18 см нежелательны).

Вес: соответствует росту собаки.

 

Недостатки: Любое отклонение от вышеуказанных пунктов должно рассматриваться как недостаток, и серьезность, с которой недостаток должен быть расценен, должна быть в точном соотношении к его степени выраженности и влияния на здоровье и благополучие собаки. 

Этот пункт относится к оценке каждой  стати собаки, описанной в стандарте. Т.е. каждый недостаток судья может оценить  по-разному: от снижения оценки до дисквалификации собаки.

 

Пороки:

 

-пороки телосложения.

-слишком плоская голова, голова в форме яблока.

— у вольфшпица большого и среднего – недостатки зубной системы.

-телесный цвет носа, век и губ

— -слишком большие и слишком светлые глаза, пучеглазие.

— пороки аппарата движения.

— отсутствие характерного рисунка на морде при волчьем окрасе.

Дисквалифицирующие пороки:

 

-агрессивность или чрезмерная трусливость,

-любая собака , имеющая явные физические или психические аномалии должна быть дисквалифицирована.

— не закрывшийся родничок,

— перекус или недокус,

— эктропия и энтропия,

— полустоячие уши,

— явные белые пятна у всех небелых окрасов,

«Очень небольшие белые пятна  на груди и кончиках лап, которые практически незаметны( не явно выраженные), можно расценивать, как недостаток».

-любой окрас, который имеет Мерле фактор. Тут следует обращать внимание на нетипичные черные пятна на собаках сплошных стандартных окрасов

 

Кобели должны иметь два нормально развитых семенника, полностью опущенных в мошонку.


Несколько слов о грумминге шпица.

Хотя грумминг стандартом не предусмотрен, современный выставочный шпиц, требует грумминга. Грумминг малого, среднего шпица и кеесхонда сводится только к приданию собаке аккуратного вида, грумминг померанца более подвержен влиянию моды и требует большего времени в подготовке шпица к выставке. При этом не следует забывать о двойной шерсти шпица, естественный вид которой  не должен быть нарушен излишним груммингом до состояния,   при котором   невозможно  определить  правильную структуру шерсти.

  

 

 

Ниже приведены ссылки на  стандарт FCI  и стандарты   стран ,  не входящих в состав FCI(  в этих странах шпицы существуют только в двух вариантах —  миниатюрная разновидность»pomeranian» и  порода » кеесхонд», которые относятся к разным группам).

СТАНДАРТ FCI:  http://www.deutsche-spitze.de/standard.html

СТАНДАРТЫ ПОРОДЫ «POMERANIAN»

СТАНДАРТ  АМЕРИКАНСКОГО КЛУБА (AKC) :http://www.akc.org/breeds/pomeranian/index.cfm

окрасы стандарта АКС и иллюстрации  : -http://www.americanpomeranianclub.org/colors.htm

Здесь следует обратить внимание на окрасы непризнанные FCI, которые присутствуют в американском стандарте наряду с признанными окрасами.

НЕПРИЗНАННЫЕ ОКРАСЫ-

бивер  (beaver) и шоколадно-соболиный ( chokolate sable). Нельзя путать стандартный кремовый окрас со светлым бивером, для которого характерны светло-коричневый пигмент мочки и обводок глаз и  очень светлые глаза . http://www.americanpomeranianclub.org/colors/Brown.htm

голубой (blue) — http://www.americanpomeranianclub.org/colors/blue.htm

голубо-соболиный ( blue sable)  и шоколадно( коричнево) — соболиный (brown sable)- http://www.americanpomeranianclub.org/colors/sable.htm

шоколадно-подпалый ( brown & tan) и голубо — подпалый ( blue & tan)- http://www.americanpomeranianclub.org/colors/tan_pattern.htm

тигровый (brindle)- http://www.americanpomeranianclub.org/colors/brindle.htm

трёхцветный ( black & tan parti color)  и мерл — голубой мерл,  мерл с подпалом и соболиный мерл( blue merle , merle& tan, sable merle ) — http://www.americanpomeranianclub.org/colors/aoac.htm

 

СТАНДАРТ  UK (Великобритании) —       http://www.thekennelclub.org.uk/item/197

СТАНДАРТ КАНАДЫ — http://www.pcoc.net/ckc-breed-standard.htm

АМЕРИКАНСКИЙ СТАНДАРТ КЕЕСХОНДА : http://www.akc.org/breeds/keeshond/index.cfm

Немецкий (Миниатюрный/Померанский, Малый) Шпиц

Многие исследователи делали попытки установить связь между померанским шпицем и собаками, жившими в Древнем Египте, Греции и Китае. В качестве доказательств они приводили многочисленные изображения, созданные в этих древних цивилизациях. Однако большинство историков, специализирующихся на изучении истории пород собак, придерживаются того мнения, что померанский шпиц происходит от собак северного типа. Такие собаки до сих пор еще встречаются в Исландии и Лапландии — там они тянут нарты по пустынным и заснеженным равнинам. И померанский шпиц, не смотря на свои маленькие размеры, по — прежнему сохраняет выносливость и типичную для собак, живущих в странах с холодным климатом, густую шерсть.

В середине ХIХ века в Центральной Европе было выведено множество пород собак, которые по окрасу и внешнему виду сходны с померанским шпицем. По мнению многих людей, померанец — это просто маленький шпиц. Порода шпиц, не признанная Американским Кеннел Клубом (АКК), имеет многочисленных «родственников» среди чистопородных собак нашего времени. Наверное, самые близкие «родственники» — это самоед и американская эскимосская собака. Родственны померанскому шпицу также такие породы, как норвежский эльхунд, шипперке, кеесхонд, итальянский шпиц и немецкие шпицы. Во Франции есть похожая порода, которую называют «лулу». В России собак из группы шпицев называют лайками.

Происхождение всех собак из группы шпицев можно проследить вплоть до собак из Исландии и Лапландии. Неизвестно был ли у всех этих собак один общий предок. Существует предположение, что эти собаки мигрировали из стран Северной Европы, таких как Финляндия, а также из Сибири. В этих холодных и безлюдных регионах ездовые собаки приносили исключительную пользу людям.

Некоторые специалисты полагают, что именно Вюртенберг  город, который в те времена был центром собаководства Германии, и стал тем местом, где шпиц превратился в померанского шпица. Другие же считают, что померанского шпица впервые вывели в Померании ( Померания — герцогство в Западном Поморье — историческая область в Северо-Восточной Европе), где в Самогитии обосновалась группа финнов.Те первые померанские шпицы весили около 14 кг. Они были совсем не такими маленькими, как современные померанцы, но все равно они явно относились к маленьким собачкам. Окрас у них был, как правило белый, кремовый или черный. Считается, что немецкие собаководы стремились вывести более мелких собачек, чем преобладавшие в то время шпицы или самоеды, поэтому они отбирали для разведения самых маленьких собачек.

Стандарт FCI № 97 (05.03.1998)

ПРОИСХОЖДЕНИЕ: Германия.

ИСПОЛЬЗОВАНИЕ: Охранная собака и собака-компаньон.

КЛАССИФИКАЦИЯ FCI: Группа 5. Шпицы и примитивные собаки (без рабочих испытаний).

КРАТКИЙ ИСТОРИЧЕСКИЙ ОБЗОР:

Немецкие шпицы являются потомками торфяной собаки каменного века «canis familiaris palustris Ruthimeyer» и более позднего «Свайного шпица», они — старейшая порода собак Средней Европы. Бесчисленные другие породы произошли от них. В некоторых странах Вольф-шпицы называются также кеесхонд, а карликовые шпицы – померанскими.

ОБЩЕЕ ВПЕЧАТЛЕНИЕ:

Шпицы отличаются прекрасной шерстью, богатый подшерсток делает ее стоячей. Особенно бросаются в глаза лежащий вокруг шеи обильный, похожий на гриву воротник и пышно обросший хвост, который отважно несется поднятым на спине. Похожая на лисью голова с живыми глазами, острые маленькие узко стоящие уши придают шпицу свойственное ему характерное бойкое выражение.

ПРОПОРЦИИ КОРПУСА: Отношение высоты к длине туловища собаки — 1 : 1.

ПОВЕДЕНИЕ И ХАРАКТЕР:

Немецкий шпиц постоянно во внимании, живой и необычайно привязчивый к своему владельцу. Он очень понятливый и легко поддается дрессировке. Его недоверие к посторонним и отсутствующий у него охотничий инстинкт делают его идеальным охранником для дома и двора. Он не боязлив и не агрессивен. Устойчивость к непогоде, крепость и долгожительство являются его выдающимися качествами.

ГОЛОВА

ЧЕРЕПНАЯ ЧАСТЬ:

Череп средней величины. Голова при взгляде сверху кажется сзади наиболее широкой и клинообразно сужается к мочке носа. Переход умеренно выражен, нерезкий.

ЛИЦЕВАЯ ЧАСТЬ:

Мочка носа: Круглая, маленькая и чисто-черная; у коричневых шпицев – темно-коричневая.

Морда: Не слишком длинная и находится в приятном пропорциональном соотношении с черепом (у вольфшпицев / кеесхондов, больших и средних шпицев отношение длины морды к длине черепа – приблизительно 2:3, у малого и карликового — приблизительно 2:4).

Губы: Умеренно выражены, плотно прилегают и не образуют складок к углам губ. У всех окрасов они черные; у коричневых шпицев — коричневые.

Челюсти и зубы: Челюсти нормально развиты и имеют ножницеобразный прикус с 42 зубами, соответствующими зубной формуле собаки, т.е. верхние зубы практически дублируют нижние и сидят перпендикулярно к челюсти. У всех разновидностей шпицев допустим клещеобразный прикус.

Щеки: Мягко округленные, не выступающие.

Глаза: Среднего размера, продолговатой формы, чуть косо поставлены, темного цвета. Пигментация век – черная у всех окрасов, у коричневых шпицев – темно-коричневая.

Уши: Маленькие, высоко посаженные и расположены близко друг к другу, треугольные и остроконечные, несутся всегда вертикально с жестким кончиком.

Шея: Средней длины, без подвеса, широко посажена на плечи, загривок чуть выпуклый. Покрыта воротником из шерсти в виде гривы.

КОРПУС

Линия верха: Начинается на острие вертикально несущихся стоячих ушей и переходит мягким сводом в короткую спину. Пышный, вибрирующий хвост, который частично закрывает спину, округляет силуэт.

Холка и спина: Высокая холка незаметно переходит в как можно более короткую, прямую, крепкую спину.

Поясница: Короткая, широкая и крепкая.

Круп: Короткий, широкий. Не скошенный

Грудь: Глубокая, с хорошим сводом, передняя часть груди хорошо развита.

Линия низа: Грудная клетка простирается по возможности дальше назад. Живот умеренно подтянут.

Хвост: Высоко поставлен, средней длины, сразу у основания повернут над спиной наверх и вперед, плотно лежит на спине, очень пышно обросший. Допускается двойной завиток на кончике хвоста.

КОНЕЧНОСТИ

ПЕРЕДНИЕ КОНЕЧНОСТИ

Общее впечатление: Прямые, широкая фронтальная линия.

Плечи: Лопатки длинные и косо направлены назад. Почти такой же длины плечо образует с лопаткой угол около 90 градусов. Плечи обладают хорошей мускулатурой и плотно прилегают к грудной клетке.

Локти: Локтевой сустав мощный, локти прилегают к грудной клетке и не сближены, но и не вывернуты.

Предплечья: Средней длины в соотношении с корпусом, коренастые и полностью прямые, на задней стороне хорошо опушены (покрыты шерстью).

Пясти: Крепкие, средней длины и находятся под углом в 20 градусов к вертикали.

Лапы: Как можно более маленькие, круглые, собранные, так называемые «кошачьи лапы», с хорошо сводистыми пальцами. Когти и подушечки черные у всех окрасов, у коричневых шпицев — темно-коричневые.

ЗАДНИЕ КОНЕЧНОСТИ

Общее впечатление: Очень мускулистые и до скакательного сустава пышно покрыты шерстью. Они стоят прямо и параллельно.

Бедра и голени: Примерно одинаковой длины.

Колени: Коленный сустав мощный, угол только умеренно выражен, при движении не выворачивается ни наружу, ни во внутрь.

Плюсны: Средней длины, очень крепкие, стоят вертикально к поверхности.

Лапы: Лапы задних конечностей не такие круглые, как передние, но хорошо сомкнутые и с грубыми подушечками. Цвет когтей как можно более темный.

ДВИЖЕНИЯ: Немецкие шпицы движутся хорошей рысью, свободно и пружинисто с хорошим толчком.

КОЖА: Плотно прилегает к корпусу, без каких-либо складок.

ШЕРСТНЫЙ ПОКРОВ

КАЧЕСТВО ШЕРСТИ: Немецкие шпицы имеют двойную шерсть: длинный, прямой, отстоящий покровный волос и короткий, плотный ватный подшерсток. На голове, ушах, передней стороне передних и задних конечностей и лапах шерсть короткая и плотная (бархатная).Остальной корпус богато покрыт длинной шерстью. Шерсть не волнистая, не курчавая или лохматая, на спине не на пробор. Шея и плечи покрыты плотной гривой. Задняя сторона передних конечностей хорошо покрыта шерстью, задние конечности от крупа до скакательного сустава в пышных штанах, хвост кустисто покрыт шерстью.

 ОКРАС:

Вольфшпиц / Кеесхонд: волчий.

Большой шпиц: Черный, коричневый, белый.

Средний шпиц: Черный, коричневый, белый, оранжевый, волчий, другие окрасы.

Малый шпиц: Черный, коричневый, белый, оранжевый, волчий, другие окрасы.

Карликовый шпиц: Черный, коричневый, белый, оранжевый, волчий, другие окрасы.

Черный шпиц: В шерстном покрове черного шпица подшерсток, а также кожа должны быть темно окрашены и окрас на поверхности должен быть лаково-черным без чего-либо белого и других отметин.

Коричневый шпиц: Должен быть равномерно темно-коричневым.

Белый шпиц: Шерсть должна быть чисто-белой, без какого-либо особенно желтоватого налета, который чаще всего встречается на ушах.

Оранжевый шпиц: Шпиц оранжевого окраса должен быть равномерно одноцветным средней интенсивности окраса.

Волчий шпиц: Волчий окрас – это серебристо-серый с черными кончиками. Морда и уши темные. Вокруг глаз отчетливый рисунок, состоящий из тонкой черной линии, которая проходит косо от внешнего угла глаза до нижнего начала уха, а также из штриховых линий и оттенков, которые формируют короткие, но выразительные брови. Грива и плечи светлые. Передние и задние конечности серебристо-серые без черных пятен ниже коленей и локтей, за исключением легкой штриховки над пальцами. Черный кончик хвоста, Нижняя часть и штаны – светло-серебристо-серые.

Другие окрасы шпицев: Под понятием «другие окрасы» подпадают такие тона как: кремовый, кремово-соболиный, оранжево-соболиный, черный с подпалом и пятнистый. Пятнистый должен иметь белый основной окрас. Черные, коричневые, серые и оранжевые пятна должны быть распределены по всему корпусу.

РОСТ:

Высота в холке:

Вольфшпиц / Кеесхонд 49 см +/- 6 см

Большой шпиц 46 см +/- 4 см

Средний шпиц 34 см +/- 4 см

Малый шпиц 26 см +/- 3 см

Карликовый / Померанский 20 см +/- 2 см (экземпляры менее 18 см нежелательны)

Вес: Каждая разновидность немецкого шпица должна иметь вес соответсвующий ее росту.

НЕДОСТАТКИ: Любые отклонения от вышеназванных пунктов должны рассматриваться как недостаток, оценка которого должна находиться в зависимости от степени отклонения.

ПОРОКИ:

Погрешность строения.

Слишком плоская голова, голова в форме яблока.

Слишком большие и слишком светлые глаза. Текущие глаза.

Мочка носа, веки и губы телесного цвета.

Неполный комплект зубов у вольфшпицев/кеесхондов, больших и средних шпицев.

Недостатки в движениях.

У волчьих шпицев отсутствие рисунка на морде.

ДИСКВАЛИФИЦИРУЮЩИЕ ПОРОКИ:

Незаросшее темя.

Недокус или перекус.

Заворот и выворот век.

Полустоячие уши.

Явные белые пятна у всех разновидностей.

ПРИМЕЧАНИЕ: Кобели должны иметь два явно нормально развитых семенника, которые полностью находятся в мошонке.

 

Вольф шпиц (Кеесхонд, голландский волчий шпиц)

Стандарт породы FCI № 97

Из истории породы: другое название породы — кеесхонд, голландский волчий шпиц. Порода выведена в Нидерландах в 16 веке. Предки кеесхонда, несомненно, северного происхождения. Эта порода, считающаяся национальной собакой Нидерландов, начала свое существование как сторож на баржах. Своим названием порода обязана популярному политическому деятелю Корнелиусу (Кеесу) Гислеару. Британское поголовье кеесхондов происходит от немецких вольфшпицев с примесью крови голландских шпицев меньшего размера и более темного окраса.

Страна происхождения: Нидерланды, Германия.

Общий вид: это гармонично сложенная, компактная собака с вертикально стоящей шерстью, хвостом, покрытым густой шерстью, головой, как у лисицы, и маленькими стоячими ушами.

Рост и вес: высота в холке: 43-55 см. Вес: 25-30 кг.

Шерстный покров: длинная, прямая, жесткая на ощупь, вертикально стоящая над густым, пушистым подшерстком. Голова, включая морду, череп и уши, покрыта мягкой, гладкой, короткой шерстью, на ушах бархатистой на ощупь. Хвост покрыт длинной пышной шерстью.

Окрас: смесь серого и черного. Подшерсток светлый: бледно-серый или кремовый, но не бурый, Покровные волосы черные на концах — от длины черных кончиков зависит характерный оттенок окраса. Морда темная. Уши очень темные, почти черные. Светло-серые полосы, идущие от холки вниз, должны быть четкими. Длинная шерсть на нижней стороне хвоста очень светлого окраса, что особенно заметно, когда он закинут на спину, кончик хвоста черный. Конечности и лапы кремовые.

Голова: пропорциональна корпусу, и, если прижать руками уши и воротник, сверху выглядит клином. Переход от лба к морде выражен. Морда средней длины, не заостренная, не грубая, пропорциональна черепу.

Уши: маленькие, треугольные, высоко поставленные и стоячие. Размер их должен быть пропорционален голове: длина внутреннего края уха примерно равна расстоянию от внешнего угла глаз до ближайшего края уха.

Глаза: темно-коричневые, среднего размера, миндалевидные, косо, не слишком широко и не слишком близко, поставленные, края век черные.

Шея: средней длины, крепкая, плавно переходит в холку.

Корпус: спина короткая, прямая, слегка понижается к крупу. Ребра округлые, поясница короткая, живот слегка подтянут.

Грудь: глубокая и сильная.

Хвост: средней длины, обильно покрыт густой длинной шерстью, высоко посажен, поднята тугом кольце над спиной и плотно прижат к корпусу.

Конечности (передние и задние): передние конечности прямые, с крепким костяком, пропорциональным общему сложению собаки, лопатки сопоставленные. Задние ноги мускулистые, плюсны отвесные, конечности кремового цвета.

Лапы: «кошачьи», когти черные.

Привлекательные черты: вольфшпиц (кеесхонд) обладает веселым и добрым нравом. Это сообразительный пес, который легко поддается дрессировке. Он дружелюбен, общителен, очень опрятен и чистоплотен. Этот ласковый песик прекрасно ладит с детьми и обожает с ними возиться, он с радостью поддержит все их детские забавы. Кеесхонд очень тонко чувствует человека и без слов способен понять, чего от него хотят или не хотят.

 

  

Производитель профессиональной амуниции и инвентаря для собак представляет подборку товаров для собак породы вольфшпиц, здесь вы найдете: шлейки и намордники из кожи и нейлона для собак породы вольфшпиц, кожаные и нейлоновые ошейники для собак породы вольфшпиц, жгуты и ухватки для мотивации и драйва вольфшпица, поводки из кожи и нейлона для собак породы вольфшпиц, корма и игрушки, аксессуары по уходу за зубами и когтями вольфшпица.

 

 

 

Немецкий шпиц

Происхождение
Предком шпицев считается ископаемая торфяная собака (Canis familiaris palustris), существовавшая в каменном веке. Таким образом, шпицеобразные собаки относятся к одним из самых древних домашних пород, происходящих от волкообразных собак. Имеется несколько пород шпицев. Вольфшпиц, также известный как волчий шпиц или кеесхонд, самый крупный из шпицев — высота в холке от 45 до 55 см. Большой шпиц (гроссшпиц) — высота в холке от 42 до 50 см. Средний шпиц (миттельшпиц) — высота в холке от 30 до 38 см. Малый шпиц (кляйншпиц) — высота в холке от 23 до 29 см. Карликовый шпиц (цвергшпиц) — высота в холке от 18 до 22 см. Вольфшпиц впервые стал популярен в Нидерландах, где эту породу называли кеесхонд в честь В. Кееса, лидера голландцев, поднявшего в XVII веке восстание против правившей тогда династии Оранских. Впоследствии кеесхонд стал популярен в США. Малый и карликовый шпицы, или померанские лулу, получили название по одноименному прибалтийскому региону Германии, где была выведена часть из них. Первый клуб шпицев создан в 1935 г. во Франции и назывался Французский клуб померанских лулу, в I960 г. он переименован во Французский клуб шпицев. Малый и карликовый шпицы — самые распространенные породы этой группы.

Характеристика породы
Энергичная, живая и бдительная собака с уверенным и независимым характером. Сильно привязывается к хозяину и порою ведет себя ревниво. Смелый, бдительный и недоверчивый к чужим людям, шпиц славится как отличный сторож (особенно вольфшпиц). По отношению к посторонним собакам проявляет сварливость. При воспитании следует проявлять твердость и терпение. Сторожевая собака, собака-компаньон.

Описание
Голова среднего размера, похожая на лисью. Череп клинообразной формы, сужающийся к заостренной морде («шпиц» означает заостренный). Переход ото лба к морде умеренно выражен. Морда не слишком длинная. Губы черного цвета, у шпицев коричневого окраса — коричневого. Глаза среднего размера, овальной формы. Поставлены чуть косо. Темные. Уши маленькие, треугольной формы, с заостренными концами. Близко поставлены. Стоячие, всегда держатся вертикально. Корпус квадратного формата. Шея сухая, средней длины, с пышным воротником. Грудь глубокая. Спина короткая, горизонтальная. Поясница короткая, широкая, сильная. Круп широкий, короткий, не округлой формы. Живот умеренно подтянут. Конечности мускулистые, с крепким костяком. Лапы круглой формы, компактные, с толстыми подушечками. Хвост очень пушистый. Собака держит его свернутым в плотное кольцо над спиной.

Шерсть длинная, прямая, не прилегающая, вертикально приподнятая. На голове, ушах, передней поверхности конечностей и лапах — густая, короткая. Шерсть не должна быть волнистой или вьющейся, а также сваленной в колтуны. Жесткая ость, очесы и штаны. Подшерсток короткий, густой, мягкий. Окрас Вольфшпиц: только волчий серый (темный серо-серебристый, серый с «углем», с черными концами остевых волос). Средний шпиц: сплошной черный или коричневый, волчий серый и другие окрасы, включая голубой, кремовый, бурый или любой из этих тонов в сочетании с белым. Карликовый шпиц: черный, коричневый, рыжий с белым, волчий серый и другие окрасы. Высота в холке зависит от разновидности: 18 — 55см. Вес Вольфшпиц: около 20 кг. Карликовый шпиц: менее 3,5 кг.

Содержание и уход
Малые шпицы лучше приспосабливаются к жизни в городе, чем большие. Необходима чистка щеткой дважды в неделю.

фото собак, описание стандарта породы и его характеристик, чем кормить кеесхонда

Характеристика породы: вольфшпиц – немецкая порода, зародившаяся в районах Северной Европы, где находятся Нидерланды и Германия. В этих землях немецкий шпиц представляет собой местную породу собак, используемую для выполнения самых разных задач от охраны до выпаса стад до сторожевой службы и сопровождения человека.

Вольфшпиц – самый крупный представитель семейства шпицев, он обладает крепким и компактным телосложением, густой шерстью с богатым подшерстком, выразительной (дикой) волчьей окраской. Международная кинологическая организация признает данную породу как одну из самых перспективных. Эти псы обладают живым характером, внимательностью и чуткостью. Все происходящие вокруг них изменения они сопровождают заливистым лаем. К незнакомцам относятся недоверчиво и агрессивно.

Примечательно, что данная порода является одной из немногих, чей облик не претерпел изменений по сравнению с первыми ее представителями. Не только внешний вид, но также поведение и черты характера остались у современных собак кеесхондов такими же, как у их далеких предков.

Другие названия породы: голландский волчий шпиц, кеесхонд.

Страна происхождения – Германия и Голландия.

Фото собаки кеесхонд представлено ниже:

Описание породы шпиц кеесхонд (с фото)

Стандарт породы: кеесхонд имеет стандарт породы FCI №97, который был принят 25.01.2013 г. Дата публикации ранее действующего стандарта: 05.03.1998 г.

Классификация породы: Группа 5. Шпицы и примитивные собаки. Секция 4. Европейские шпицы. Без рабочих испытаний.

Особенности породы: кеесхонд (см. фото) – компактная собака средних размеров и корпусом квадратной формы. Пес обладает яркой, привлекательной внешностью. Его голова клинообразно сужается к мочке носа, задняя часть более широкая, что напоминает лисью морду. Однако морда не слишком длинная, почти пропорциональная черепу (соотношение длины морды к длине черепа примерно 2:3). Мочка носа маленькая, округлой формы, исключительно черного цвета.

Губы черные, плотно прилегающие, складок у рта не образуют. Челюсти хорошо развиты, с правильным ножницеобразным прикусом. Нормой для представителей данной породы является наличие 42 зубов, расположенных вертикально. Скулы округлые, не выступающие.

Глаза слегка косо поставленные, овальные, темно-коричневые. Уши маленькие, высокопоставленные, стоячие, треугольные. Шея средней длины, без подвеса, но кажется короткой из-за длинной пышной шерсти, образующей густую гриву. Верхняя линия корпуса начинается с кончиков заостренных ушей и переходит в прямую короткую спину.


[includeme file=»wp-content/plugins/include-me/goog-right.php»]

Поясница крепкая, широкая. Круп короткий, не скошенный. Грудь глубокая, с развитой передней частью. Живот подобран. Хвост высоко посажен, свернут в кольцо, лежит на спине, очень пушистый. Передние конечности прямые. Плечи мускулистые, плотно прилегающие к грудной клетке. Локтевые суставы крепкие. Передние лапы маленькие, округлые, собранные, со сводистыми пальцами. Когти и подушечки черные. Задние конечности сильные, мускулистые, до скакательного сустава покрыты пышной шерстью. Задние лапы маленькие, сводистые, с грубыми подушечками.

При описании породы кеесхонд следует отметить, что шерсть у таких собак двойная, длинная, прямая, с коротким, плотным подшерстком. На голове, ушах, передней стороне конечностей и лапах шерсть короче, чем на остальном корпусе. На шее и плечах толстый слой шерсти образует пышный воротник, на задней части конечностей – «штаны».

Окрас шерсти кеесхонда или вольфшпица зонарно-серый, то есть волчий, с черной маской, черными ушами и черным кончиком хвоста. Оттенок шерсти вокруг глаз более светлый. У некоторых псов от наружного уголка глаз наискосок идут прямые тонкие черные линии.

Высота в холке: 43 – 55 см.

Вес: 25 – 30 кг.

Продолжительность жизни: 16 – 17 лет.

На фото, представленном ниже, хорошо просматриваются все внешние особенности шпица кеесхонда:

[includeme file=»wp-content/plugins/include-me/ya1-h3.php»]

Характер кеесхонда (вольфшпица)

Характер (поведение) собаки: шпиц кеесхонд считается идеальной семейной собакой и прекрасным компаньоном для своих хозяев. Издавна этих псов использовали в качестве сторожа, а также для охраны и выпаса скота. Небольшая группа кеесхондов будет ответственно охранять имущество и оберегать стадо от хищных животных. Кроме того, представители данной породы очень привязаны к дому. По характеру они приветливы и дружелюбны, ласковы, преданны, легко уживаются с домашними питомцами. Вряд ли найдутся те, кто пожалел о том, что взял на воспитание собаку такой породы, поскольку проблем она практически не доставляет. Ей не свойственны агрессия, злоба, назойливость и капризность. Щенки вольфшпица активны и любознательны. Пожалуй, нет в квартире такого места, которое они не изучили бы. Им потребуется уделять много времени и внимания, заниматься и играть с ними, проявлять любовь и ласку. У чутких, заботливых хозяев щенок превратится в дружелюбную, любвеобильную, преданную собаку. К посторонним пес относится настороженно, но без агрессии. Характеристика кеесхонда будет неполной, если не упомянуть о том, что это животное весьма чистоплотно и подобно кошкам умывается лапой.

Активный вольфшпиц (см. фото) подвижен и энергичен, любит прогулки, игры на свежем воздухе, с удовольствием плавает, купается в снегу, легко обучаем, поэтому повышать голос и применять физическую силу на тренировках не придется.

[includeme file=»wp-content/plugins/include-me/goog-left.php»]

Кеесхонд вольф шпиц чуток и внимателен к настроению хозяина и в трудную минуту может стать для него хорошим психологом. Вместе с тем он никогда не будет надоедать, и если в нем нет потребности, пес спокойно уйдет на свое место.

Интересен факт, что порода собаки вольфшпиц используется в психиатрии при коррекции поведения больных людей. Положительная энергетика, веселый, добрый характер кеесхонда творят чудеса. Животное приносит радость пациентам с тяжелыми заболеваниями, вселяют в них оптимизм и веру в лучшее, доброе. В Америке немецким шпицам разрешается находиться в кабинете психиатра во время приема, так как своим присутствием они снимают напряжение с пациента, помогают врачу найти контакт с больным.

На основе опыта многих семей, воспитывающих эту породу, присутствие в доме чутких, преданных, дружелюбных псов сплачивает всех членов семьи, а при конфликтах помогает наладить отношения домочадцев.

История породы кеесхонд вольф шпиц

Вольфшпиц является одной из самых древнейших собак. История породы кеесхонд вольф шпиц берет свое начало в Европе в 16 веке. В этот период шпицев разных окрасов и размеров разводили во многих европейских государствах. Черные и коричневые псы были предназначены для охраны крупных виноградных плантаций в Вюртемберге, белые приобрели популярность в Померании и прочих провинциальных городах, маленькие шпицы стали домашними любимцами и компаньонами многих семей. Большие собаки волчьего окраса охраняли дома, имущество, скот, а также лодки рыбаков. В Голландии их прозвали кеесхондами, в Германии – вольфшпицами.

Предки породы голландский кеесхонд не отличались аристократизмом, ростом и силой, быстрым бегом или мертвой хваткой. К ним не проявляли интерес собаководы. На протяжении долгих лет эти псы жили рядом с человеком, не только охраняя его дом, но ответственно выполняя все необходимые обязанности сторожа и собаки — пастуха. Средние размеры, приятная внешность, прекрасные качества характера позволили стать им собакой на все случаи жизни. В любых условиях голландские кеесхонды сохраняли здоровье, быстро адаптировались, проявляли высокий уровень обучаемости, понимали человека с полуслова, стремились быть рядом с ним, но в тоже время, оставались ненавязчивыми. Благодаря данным качествам порода пережила столетия и почти не претерпела изменений.

В Голландии больших шпицев называли «баржевыми собаками», поскольку их хозяевами здесь были в основном моряки, лодочники, рыбаки. Псы охраняли баржи и сопровождали своих владельцев в дальних плаваниях.

В Германии представители породы смешались с местными шпицами и получили название «вольфшпицы». Они немного изменились внешне и по характеру и стали отдельной породой. При их разведении заводчики уделяли особое внимание рабочим качествам и развитию охранных инстинктов, тогда как при разведении кеесхондов в приоритете стояли экстерьерные качества. В настоящее время эти породы объединены одним стандартом, так как отличий между ними практически не осталось.

Уход за собаками породы вольфшпиц

Решив обзавестись таким питомцем, следует учесть, что воспитание щенка потребует внимательного и продуманного подхода. Уход за собаками породы вольфшпиц непрост, эти животные подходят для содержания как в квартирных условиях, так и загородом. И в том, и в другом случае животному понадобится вычищение длинной, густой шерсти с помощью специальной щетки. Вычесывание полезно еще и тем, что во время этой процедуры собака получает массаж кожи, улучшающий кровообращение. В периоды между линьками данную процедуру следует выполнять 2 – 3 раза в месяц. Слишком часто это делать не рекомендуется, поскольку частые вычесывания приведут к ухудшению качества шерсти и подшерстка. Линька кобелей бывает раз в год, у сук – 2 раза. В это время в квартире появляются комочки шерсти, которые очень легко удаляются, так как шерстинки не распадаются и не липнут к предметам мебели и одежде. Линяющую шерсть вычесывают 2 – 3 раза в неделю. Линьки длится 3 – 4 недели.

Животное не нуждается в частых купаниях, достаточно мыть его по мере загрязнения шерсти. Частые купания приводят к раздражению кожи и потере защитного слоя шерсти.

Чем кормить шпица кеесхонда

Порода собак кеесхонд склонна к полноте и ожирению, поэтому важно следить за рационом своего питомца. На вопрос «чем кормить кеесхонда» правильным ответом будет сухой сбалансированный корм, подходящий для этого вида собак. Кормить нужно 2 раза в день, соблюдая указанные на упаковке пропорции.

[includeme file=»wp-content/plugins/include-me/ya2-h3.php»]

Дрессировка голландского волчьего шпица

Дрессировать такого питомца не сложно, ведь он достаточно умен, сообразителен, стремится понять и порадовать своего хозяина, благодаря этому быстро учится самым сложным трюкам. Поощрять его за старание и успехи можно лакомствами и добрыми словами. Хорошим стимулом для достижения больших результатов станет для собаки доброжелательное отношение тренера и его улыбка. Во время дрессировки голландского волчьего шпица следует помнить, что кеесхонды реагируют на интонации голоса. Так, при агрессии и крике их желание тренироваться исчезает. Если же дрессировка проходит весело и игриво, собака будет стремиться сделать больше, чтобы порадовать свою семью.

Как выглядит порода кеесхонд вольфшпиц, на фото смотрите ниже:


Померанский шпиц черного, шоколадного окраса. Мраморные шпицы. | Питомник — LUXPOM! | Питомник

Карликовый шпиц, несомненно, станет главным любимцем семьи. Но чтобы щенок участвовал в выставках, цвет шерсти пушистых «комочков» должен соответствовать стандартам, принятым кинологической федерацией. Опытные заводчики знают, как заранее определить оттенок, ведь его окончательная глубина формируется после первой сезонной линьки. В Imperial Family вы можете купить щенков, исходя из их окраса, и не переживать, что пушистый «комочек» изменит свой цвет.

Общие стандарты и признанные окрасы

Согласно стандартам кинологической федерации, допустимые оттенки шерсти варьируются в зависимости от типа породы. Основные окрасы, в которых представлен померанский шпиц: черный, белый, шоколадный, волчий или рыжий. Но есть ряд других оттенков, которые менее распространены среди пушистых «мишек». В связи с этим цена на щенков редкой расцветки выше, чем стоимость основных окрасов. Но когда речь идёт о том, чтобы купить «клубочек счастья» для семьи, не имеет значения, будет это щпиц коричневый или белый, ведь вы приобретаете маленького верного друга, который подарит много радости и удовольствия.

Чёрный цвет характеризуется полностью лаковым оттенком, на котором отсутствуют пятна. Шёрстка маленьких щенков обычно бурая или тёмно-серая. С возрастом лаково-чёрный окрас может приобрести другой оттенок или «разбавиться» сединой, но данные изменения не являются браком.

Элитный белый «комочек» обладает ровным цветом без иных примесей. Чтобы добиться снежного оттенка, родословная щенка должна состоять из «чистых» родственников. Любые отклонения в расцветке способствуют кремовому окрасу.

Самый распространённый — золотисто-рыжий цвет. Маленькие пушистики в детстве могут обладать светлым или серым оттенком, который с возрастом приобретёт глубину. Согласно стандарту, равномерное распределение цвета не является обязательным условием для получения высоких оценок на выставках.

Карликовый шпиц соболиного окраса покрыт серебристой шерстью. Насыщенность и глубина цвета изменяется в зависимости от части тела. К этой группе относятся и другие оттенки:

  • рыжего;
  • кремового;
  • оранжевого.

Всем видам характерно зонарное окрашивание. Мордочка и ушки тёмные, плечи и головка светлые, конец хвоста чёрный, «штанишки» серебристые или серые.

Другие оттенки и пороки

Кроме основных окрасов, элитные домашние «мишки» могут обладать и другими редкими оттенками шерсти. Шоколадный шпиц — коричневый цвет, который равномерно распределён по всему телу пушистика. Тигровый характеризуется чередованием чёрных и рыжих полос. Мраморный шпиц — уникальная и редкая расцветка. По его телу распределены чёрные, рыжие или серые отметины. А пятна на белом фоне шерсти — это пати-колор.

Некоторые окрасы приняты американскими стандартами, но отсутствуют в списке чистопородного собаководства международной ассоциации. Этими представителями являются: шпиц коричнево-шоколадный, голубой, мерле и тигровый.

Основные пороки — это белые пятна на шерсти всех представителей, кроме «снежных» щенков. Не ведут к дисквалификации маленькие отметины на груди и лапах, светлая мочка носа в зимний период, что присуще пушистикам светлых оттенков. Если вы решили купить щенка шпица мраморного окраса и другого цвета для выставки или разведения, доверьтесь надёжным заводчикам.

Компанией Imperial Family осуществляется продажа элитных щенков. Цена зависит от окраса «шубки». Хотите стать обладателем маленького, активного и преданного щенка? Огромное количество жителей в России обрели друга в представителе королевской породы. Проживая в Москве или за её пределами, посетите наш питомник элитных щенков, которые не оставят вас равнодушными.

Померанский Шпиц — artmoris

Стандарт породы Померанский шпиц FCI № 97 (5.03.1998).

 

ПРОИСХОЖДЕНИЕ: Германия.

 КЛАССИФИКАЦИЯ FCI:

 Группа 5

Шпицы и примитивные собаки

Без рабочих испытаний

 ИСПОЛЬЗОВАНИЕ: Охранная собака и собака-компаньон.

 Краткая историческая справка:

Немецкие шпицы являются потомками жившей в каменном веке «торфяной собаки» и представляют собой самую древнюю породу собак Центральной Европы. Они стали прародителями многих других пород. В не немецкоязычных странах вольфшпицы называются также кеесхондами, а миниатюрные шпицы-померанцами.

 Комментарий:

Кеесхонды (порода получила это название в начале 20-х годов прошлого столетия в Голландии) и вольфшпицы довольно долго развивались обособленно друг от друга, но так как они несомненно имеют общее происхождение, последний стандарт FCI объединил их в одну породу. Название «померанский шпиц» или «померанец», принятое в Англии, где впервые началась миниатюризация породы, Америке и некоторых других странах, произошло от названия Померании -одной из областей Германии.

 Поведение и характер:

Немецкий шпиц постоянно во внимании, живой и необычайно привязанный к своему владельцу. Он очень понятливый и легко обучается. Его недоверчивость к посторонним и отсутствие у него охотничьего инстинкта, делают его идеальным охранником дома и двора. Он не боязлив и не агрессивен. Устойчивость к непогоде, прекрасное здоровье и долголетие являются его выдающимися качествами.

 Общее впечатление:

Шпицы подкупают своей прекрасной, стоячей (из-за богатого подшерстка) шерстью. Особенно впечатляет роскошный воротник вокруг шеи и очень пушистый хвост, который шпиц задорно несет на спине. Похожая на лисью голова с юркими глазками, острые, маленькие, близко поставленные стоячие уши придают шпицу характерный задорный вид.

 Важнейшие пропорции:

Высота в холке: косая длина туловища= 1 :1

Размеры:

Высота в холке:

Вольфшпиц / Кеесхонд 49 см + — 6 см

Большой шпиц 46см + — 4 см

Средний шпиц 34 см + — см

Малый шпиц 26 см + — 3 см

Миниатюрный /Померанский 20 см + — 2 см (экземпляры ниже 18 см нежелательны).

Вес: соответствует росту собаки.

 ГОЛОВА: Череп средней величины. Голова при взгляде сверху клинообразно сужается к мочке носа. Переход — умеренно выраженный до выраженного, никогда не резкий. Комментарий: чем меньше размер шпица, тем более выражен переход.

 МОРДА: не слишком длинная, не грубая, но и не заостренная, находится в гармоничной пропорции с черепом (у вольфшпицев, больших и средних шпицев — соотношение длины морды к длине черепа приблизительно 2:3, у малого и миниатюрного шпица-2:4).

 МОЧКА НОСА: круглая, маленькая, всегда черная (у коричневых — в тон окраса).

 ГУБЫ: плотно прилегают и не образуют складок в углах пасти. Пигментация-всегда черная (у коричневых — в тон окраса).

 ЧЕЛЮСТИ И ЗУБЫ: челюсти нормально развиты и имеют ножницеобразный прикус с 42 зубами (у миниатюрного и малого шпица допускается отсутствие некоторых премоляров). Клещеобразный прикус допустим у всех разновидностей шпицев.

 СКУЛЫ: мягко округленные, не выступающие.

 ГЛАЗА: среднего размера, миндалевидные, чуть косо поставлены, темного цвета. Веки с черной пигментацией у всех окрасов (у коричневых шпицев – в тон окраса).

 УШИ: маленькие, посажены высоко и относительно близко друг к другу, треугольные, остростоячие с жесткими кончиками.

 ШЕЯ: средней длины, в плечах широкая, слегка выгнутая в загривке, без подвеса, покрыта обильной шерстью в виде гривы.

 КОРПУС:

ЛИНИЯ ВЕРХА: начинается с кончиков стоячих ушей и плавной дугой переходит в короткую прямую спину.

Поясница: короткая, широкая.

Круп: широкий и короткий, не скошенный.

Грудь: глубокая, с хорошим сводом, хорошо развит форбруст.

Линия низа: грудная клетка как можно более длинная, живот умеренно подтянут.

 Хвост: высоко посажен, средней длины, от корня сразу же поднимается вверх, закинут вперед и на спину, плотным кольцом прилегает к спине, очень пушистый.

 Передние конечности

* Общее впечатление: прямой, широкий фронт.

* Плечи: с хорошей мускулатурой, плотно прилегают к грудной клетке. Лопатки длинные и косо направлены назад, почти такой же длины плечо образует с лопаткой угол приблизительно 90 гр.

* Локти: локтевой сустав крепкий, локти прилегают к грудной клетке, не вывернуты ни наружу, ни внутрь.

* Предплечья: средней длины, крепкие, совершенно прямые, с хорошими очесами на задней стороне.

* Пясти: крепкие, средней длины, образуют с вертикалью угол

* Передние лапы: по возможности маленькие, круглые, собранные, т.н. «кошачьи лапы». Когти и подушечки чёрные, темно-коричневые у всех коричневых шпицев.

 Задние конечности

* Общее впечатление: Задние конечности очень мускулистые, роскошные штаны до скакательных суставов. Задние конечности прямые, параллельны друг другу.

* Бедро/Голень: Бедро и голень приблизительно равны по длине.

* Колено: Коленный сустав крепкий, угол умеренный, в движении не выносится ни наружу, ни внутрь.

* Плюсна: Плюсна средней длины, очень крепкая, ставится вертикально к земле.

* Задние лапы: Лапы на задних конечностях по возможности маленькие, круглые, пальцы хорошо прилегают друг другу, сводистые, т.н. кошачьи лапы, подушечки плотные. Цвет подушечек и когтей возможно более темный.

 Движения

Движения немецких шпицев с хорошим толчком, по прямой, свободные и пружинистые.

 Кожа

Туго прилегает к телу, не образуя складок.

 Шерстный покров

Шерстный покров двойной – длинный, прямой, отстоящий покровный волос и короткий, густой подшерсток. Голова, уши, передняя сторона передних и задних конечностей, лапы покрыты короткой и плотной шерстью, остальные части тела покрыты длинной и богатой шерстью; не волнистой, не курчавой, не образующий на спине пробора. На шее и плечах густая грива. На задней стороне передних конечностей очесы. Задние конечности от крупа до скакательных суставов имеют роскошные штаны, хвост обильно опушен.

 Окрас

* Вольфшпиц: волчий.

* Большой шпиц: черный, коричневый, белый.

* Средний, малый и миниатюрный шпиц: черный, коричневый, белый, оранжевый, волчий и другие окрасы.

* Черный окрас: однотонный глубокий черный без белых пятен или иных оттенков.

* Коричневый окрас: равномерно-однотонный, темно-коричневый.

* Белый окрас: чисто белый, без каких-либо оттенков.

* Оранжевый окрас: равномерно-однотонный цвет в средней шкале цветовой гаммы.

* Волчий окрас: серебристо-серый с черными кончиками волос, на морде и ушах шерсть темная, вокруг глаз отчетливый рисунок из тонкой черной линии, проходящей по косой от наружного угла глаза до нижнего основания уха, грива и воротник на плечах светлые, черный кончик хвоста, нижний кончик хвоста и штаны светло-серебристого цвета.

* Другие окрасы: под термином «другие окрасы» понимают такие, как: кремовый, кремово-соболиный, оранжево-соболиный, черно-подпалый, пятнистый. Основной фон пятнистых собак – белый. Черный, коричневые, серые или оранжевые цветовые пятна распределяются по всему корпусу.

 Недостатки

недостатком считается любое отклонение от названных пунктов, оценка соответствует степени выраженности.

 Пороки

* пороки телосложения;

* слишком плоская голова, голова в форме яблока;

* у вольфшпица большого и среднего – недостатки зубной системы;

* слишком большие и слишком светлые глаза, пучеглазие;

* пороки аппарата движения;

* отсутствие характерного рисунка на морде при волчьем окрасе.

 Дисквалифицирующие пороки

* не закрывшийся родничок;

* перекус или недокус;

* эктропия и энтропия;

* полустоячие уши;

* явные белые пятна у всех небелых окрасов;

* крипторхизм и недоразвитый семенник.

Собака вольфшпиц (кеесхонд): особенности и фото

Вольфшпиц или Кеесхонд — породы немецких шпицев. Международная кинологическая федерация (FCI) объединяет их по одному стандарту с четырьмя другими типами, каждый из которых имеет свои небольшие отличия. Другие породы, включенные в эту группу: вольфшпиц или кеесхонд, крупный шпиц, средний шпиц, малый шпиц и карликовый шпиц или померанский шпиц.

Все эти породы очень похожи, за исключением размера и цвета шерсти у некоторых.Хотя FCI объединяет их вместе и считает, что они имеют немецкое происхождение, вольфшпиц и померанский шпиц рассматриваются другими организациями как самостоятельные расы.

Источник

  • Европа
  • Германия
  • Нидерланды

Высота

  • 5-14
  • 14-18
  • 18-22
  • 22-27
  • 27-31
  • Более 31

Вес взрослого

  • 2-7
  • 7-22
  • 22-55
  • 55-100
  • 100-220

Рекомендуемая физическая активность

Происхождение вольфшпица

Считается, что вольфшпиц, который использовался в качестве собаки-компаньона с момента своего появления, имеет голландское происхождение (Нидерланды) и в восемнадцатом веке был известен как «народная собака» .Порода происходит от своих родственников чау-чау, элкхаундов, самоедов и померанских шпицев. Вольфшпица также называют кеесхондом, потому что в начале Французской революции патриот по имени Гизелар имел собаку этой породы по кличке Кеес и сделал ее символом голландской родины. Остальное уже история!

Вольфшпицы впервые были представлены миссис Вингфилд-Дигби в Соединенном Королевстве, но они не пользовались популярностью до 1920 года, когда они прибыли в Соединенные Штаты. Так, в 1930 году порода была признана Американским клубом собаководства.

Физические характеристики вольфшпица

Все немецкие шпицы (кеесхонд, большой, средний, малый и померанский шпиц) имеют одинаковую физическую форму и, следовательно, одинаковый внешний вид. Единственная разница между этими породами заключается в размере, а у некоторых и в окрасе. Однако все эти красивые собаки выделяются своим замечательным мехом.

Голова вольфшпица среднего размера и сверху выглядит клиновидной, очень похожей на голову лисы. Нос круглый, маленький и черный, за исключением коричневых собак, у которых он темно-коричневый.Их глаза средние, удлиненные, косые и темные. Их уши треугольные, заостренные и стоячие.

Их высота почти равна их длине, поэтому они имеют квадратный профиль. Их спина и круп короткие и сильные. Грудь у них глубокая, а живот умеренно собран. Их хвост торчит высоко и слегка загнут внутрь. Он покрыт обильной густой шерстью.

Шерсть вольфшпица состоит из двух слоев шерсти. Внутренний слой короткий, плотный и пушистый.Внешний слой образован длинных, прямых и отдельных волос. Голова, уши, передняя часть стопы и ступни имеют короткую, густую и бархатистую шерсть. Их шея и плечи имеют очень пышную гриву. Нормальный цвет для вольфшпица или кеесхонда сероватый, а их размер составляет 49 ± 6 см по данным FCI.

Темперамент вольфшпица

Несмотря на различия в размерах, все немецкие шпицы, от кеесхонда до померании, имеют общие основные характеристики темперамента.Эта порода жизнерадостная, бдительная, динамичная и очень привязана к своей семье, но также сдержанна с незнакомцами и лающими, поэтому они могут быть хорошими сторожевыми собаками; хотя они не годятся в качестве сторожевых собак.

Если щенки хорошо социализированы, вольфшпиц без проблем переносит незнакомцев, но могут возникнуть конфликты с собаками того же пола. Они обычно хорошо ладят с другими домашними животными в своем доме, как и с людьми.

Несмотря на то, что они хорошо социализированы, эти собаки обычно не подходят для очень маленьких детей, так как их поведение реактивно.Они могут укусить или покусать, если с ними плохо обращаются, даже если это происходит непреднамеренно. Вместо этого они хорошие компаньоны детей старшего возраста , которые умеют заботиться и уважать собаку.

Уход за вольфшпицем

Шерсть всех немецких шпицев должна расчесываться не менее трех раз в день , чтобы содержать ее в хорошем состоянии и не запутывать. Во время линьки шерсть необходимо расчесывать ежедневно, чаще.

Эти собаки динамичны, но им следует высвобождать свою энергию с помощью упражнений, ежедневных прогулок и игр. Они могут хорошо приспособиться к жизни в небольших квартирах или домах, но лучше, если у них будет небольшой сад, особенно для более крупных рас, таких как вольфшпиц.

Все эти породы, включая вольфшпица, хорошо переносят холодный и умеренный климат, но не переносят сильную жару. Из-за своего защитного покрова они могут жить снаружи, но лучше, если они живут в доме, так как им нужна компания их человеческих семей.

Дрессировка вольфшпица

Основной поведенческой проблемой любого немецкого шпица, в данном случае вольфшпица, является их чрезмерный лай.

Их легко обучать с помощью позитивных стилей обучения , а из-за их динамизма обучение с помощью кликера представляется хорошей альтернативой их обучению.

Общие проблемы со здоровьем вольфшпица

Как и вольфшпиц, все породы немецких шпицев, как правило, здоровы и не проявляют большого количества заболеваний собак. Однако наиболее распространенными заболеваниями у этой группы пород, кроме шпицев, являются: дисплазия тазобедренного сустава, проблемы с кожей и эпилепсия.

Вольфшпиц (кеесхонд) фото

Волчий шпиц, Информация о породах собак

Самый крупный из европейских шпицев, с густой торчащей шерстью в характерной волчьей шерсти. Приятный компаньон, держащийся на расстоянии от незнакомцев. Вопреки названию, волчий шпиц от волка имеет в основном шерсть — к тому же это очень цивилизованная собака. К характерным чертам шпица относятся стоячие уши и закрученный хвост. Шпиц – одна из самых оригинальных форм собаки.

Природа

Шпиц — одна из самых оригинальных форм собаки. Различные их типы независимо развились в Азии и Европе. В других регионах мира возникли различные типы примитивных четвероногих, такие как собаки щенси и парии, которые имеют много общего со своими собаками-шпиц.

Характерными чертами шпица являются стоячие уши (хотя у некоторых особей они иногда бывают унылыми) и загнутый назад хвост. Первый является исходным признаком диких псовых, второй связан с одомашниванием.Подобные противоположности можно увидеть и в психике этих собак – независимых и в то же время преданных человеку.

Навыки

Европейские шпицы

, в том числе немецкий шпиц, являются одними из самых цивилизованных – их гораздо легче дрессировать, чем охотничьих или ездовых разновидностей. Неудивительно – они служили универсальными сельскохозяйственными собаками, в основном сторожевыми, а некоторых использовали в качестве пастушьих собак. Поэтому они жили в непосредственной близости от человека.

Действующий стандарт, действующий в FCI, различает пять пород немецких шпицев: большой, средний, малый и миниатюрный шпиц нескольких окрасов и самый большой и единственный волчий шпиц с одной шерстью.Помимо роста волос, цвета шерсти и различий в пропорциях, все они имеют один рисунок.

Европейская популяция волчьих шпицев была создана из сочетания немецкого волчьего шпица и голландского кеесхонда – собак, которые больше связывали, чем разделяли. Несмотря на это, однако, между экстерьером и психикой этих двух типов все же есть некоторые различия.

Кеесхонд в среднем немного мельче волчьего шпица и чаще имеет темную окраску шерсти со светлыми очками.Кеесхонд дольше разводился американцами как выставочная собака, что означало, что у него более крупный стоп и более круглые глаза, а также более коренастое телосложение.

Различия касаются и характера – волчий шпиц должен быть недоверчивым к незнакомцам, а кеесхонд более открытым. Некоторые предполагают, что его скрестили с нордическим шпицем, но, возможно, это вопрос селекции в другом направлении. В европейской популяции среди волчьих шпицев сегодня мы можем найти черты обоих типов, смешанные в разных пропорциях.

Волчий шпиц. Обучение и образование

Независимо от породы, шпиц — собака, преданная хозяину. Умный, быстро учится. Дрессировать его следует щадящими методами, но при этом помнить о железной консистенции. Некоторая самостоятельность шпица означает, что как только он почувствует слабость опекуна, то не станет его слушать. Предпочтительно выбирает одного человека, чьи поручения он выполняет.

Он чувствителен ко всей семье и легко идет на контакт.Обычно недоверчивы к незнакомцам, но есть и дружелюбные особи. Нельзя пренебрегать приручением его в молодом возрасте различными явлениями, ведь он чувствителен к раздражителям.

Очень хорошо ладит с домашними животными. Встречи с иностранными четвероногими на прогулках обычно проходят гладко, хотя самцы могут вступить в стычку.

Эта собака требует среднего количества движений и занятий. Он приспосабливается к разным образам жизни. Может заниматься собачьими видами спорта, например. ловкость и послушание.

Для кого эта гонка?

С его воспитанием справится даже начинающий хозяин, если он будет последовательным. Волчий шпиц может жить в хижине, но должен иметь тесный и постоянный контакт с людьми.

Волчий шпиц. Преимущества и недостатки

Недостатки

  • может быть довольно упрямым
  • любит лаять
  • сильно линяет
  • может переносить много грязи на шерсти

Преимущества

  • привязывается к человеку
  • жадный, что облегчает обучение
  • обычно неконфликтный
  • легко принимает домашних животных
  • ему достаточно умеренного движения
  • шерсть обладает свойствами самоочищения
  • 17 90.Здоровье

    Как правило, это здоровая и долгоживущая порода, а генетические проблемы возникают спорадически.

    Кормление

    Он жаден, и это большое преимущество при дрессировке — хотя будьте осторожны, потому что его легко откормить. Как сельская собака по происхождению, он хорошо усваивает пищу и не имеет особых потребностей в питании.

    Уход

    Уход за шпицей

    прост – расчесывать нужно всего раз в неделю (всего два раза в год, в период более интенсивной линьки это нужно делать чаще).

    История

    Считается, что предком европейского шпица была торфяная собака (Canis familiaris palustris). Это четвероногие животные, останки которых насчитывают около пяти тысяч. лет были найдены в торфяных пластах на территории современной Швейцарии. Там на болотах строили дома на сваях — отсюда и латинское название собаки.

    Останки подобных животных также были обнаружены в районе между Боденским и Ладожским озерами в России. Неизвестно, были ли они именно шпиц-типа, но считается, что от них произошли европейские шпицы, шнауцеры и пинчеры, терьеры и европейские овчарки – немецкие, бельгийские или колли (в отличие от лохматых овчарок, происходящих от терьера), тибетские и горные собаки, чьи предком был тибетский мастиф).Это были собаки, служившие охранниками и пастухами.

    Их одомашнивание произошло в то время, когда человек стал вести оседлый образ жизни, и было связано с одомашниванием других животных. (Предки этих собак сопровождали европейских кочевников еще в эпоху неолита – около 6000 лет назад). Так что психику четвероногих пришлось серьезно изменить. Одной из особенностей немецких шпицев является ослабление охотничьего инстинкта по сравнению с лайкой или хаски.

    Трудно определить, когда начинается современная история волчьего шпица.В Германии собаки типа шпиц известны на протяжении столетий – точно так же в Нидерландах или Швейцарии. В Германии их называли Mistbeller, что означает «лающий навоз». Хранитель фермы выбрал самую высокую точку обзора и оттуда объявил о приближении злоумышленников.

    Эти собаки были разных размеров и окрасов и использовались, в частности, для наблюдения за повозками или стадными животными. В Нидерландах подобные четвероногие плавали на плечах.

    Перелом в их истории произошел в 18 веке, когда Ежи I взошел на английский престол.Он также был курфюрстом Ганновера, женатым на немецкой аристократке. Укрепление отношений с Германией привело к завозу на острова предков современных немецких шпицев. Там они вошли в моду как «померанские» — собаки из Померании (лат. Pomerania). Однако они были не такими мелкими, как нынешний померанский шпиц (миниатюрный шпиц), а были размером с современных крупных и средних шпицев. Их возлюбленной была королева Виктория, которая способствовала выведению миниатюрной разновидности.

    Шаблон

    Волчий шпиц – группа V FCI, раздел 4, каталожный номер 97

    • Страна происхождения: Германия
    • Характер: жизнерадостная собака, преданная хозяину, недоверчивая к незнакомцам, бдительная охрана; может лаять
    • Размер:   кобели и суки 43-55 см
    • Вес:   20-30 кг
    • Шерсть:  двухслойная: длинная, короткая, жесткая и торчащая, густая и торчащая. подшерсток; голова, уши и лапы покрыты короткой густой шерстью, остальное тело – длинной шерстью, что создает обильную гриву на шее и плечах, штаны и перо на хвосте; Шпиц линяет постоянно, но два раза в год более интенсивно хотя он относится к примитивным породам, его относительно легко формировать
    • Активность:   средний; любит движение, но если ему давать регулярные прогулки, он адаптируется к менее активному образу жизни; он счастлив в саду днем ​​
    • Устойчивость/восприимчивость к болезням:   очень устойчив к холоду и морозу, плохо переносит жару; достаточно здоровая порода, хотя встречаются дисплазия, эпилепсия и кожная аллергия
    • Возможность купить щенка: Щенка обычно нужно заказывать

    Интересные факты

    Волчий шпиц вовсе не более тесно связан с волком, чем другие собаки, вопреки тому, что следует из названия.Он связан с окрасом этой породы, которую называют «волкодав» — это исходный тип окраса, встречающийся у многих других пород, в том числе у немецких овчарок.

    В Нидерландах восемнадцатого века кеесхонд стал символом сопротивления со стороны фракции патриотов (это было демократическое движение, основанное на среднем и мелком среднем классе, требовавшее реформы государства и истощения власти губернатора), в оппозиции к мопс, который был символом оранжистов (поддерживающих династию Орангов).

    Какая собака ближе всего к волку (Список самых близких пород)

    И собаки, и волки принадлежат к семейству псовых, хотя и полностью отличаются друг от друга. В то время как один — лучший друг человека, другой — опасный вид и главный хищник в экосистеме.

    Собаки были приручены около 15 000 лет назад, чтобы счастливо сосуществовать с людьми. Однако волки остались в дикой природе и, как правило, держатся подальше от людей.

    Однако это не значит, что некоторые собаки не дружат с волками.Некоторые породы настолько похожи на людей, что люди часто путают собаку и волка.

    Давайте посмотрим, какие породы собак ближе всего к волкам и почему они близки к своему дальнему родственнику — волку.

    Что роднит некоторые породы собак с волками?

    Основная причина близости пород собак к волкам – это их генетика. Собаки являются дальними родственниками волков, и это видно из исследований, проведенных на этих двух животных.

    Др.Роберт К. Уэйн, биолог псовых и молекулярный генетик, утверждает, что современные собаки отличаются от серых волков только на 0,2% ДНК.

    Это невероятно небольшая разница, учитывая, что койоты часто считаются ближайшими родственниками волка, а также имеют 4-процентную разницу в ДНК.

    Это означает, что собаки в 20 раз ближе к волкам, чем койоты с точки зрения их генетики. Некоторые собаки ближе к волкам, чем другие, из-за скрещивания, из-за которого они выглядят и ведут себя так по-разному.

    Собаки, наиболее близкие волкам по внешнему виду

    Когда люди думают о волках и породах собак, многие автоматически думают о хаски. И у хаски, и у волков квадратная морда, заостренные короткие уши, мускулистое тело и схожая форма глаз.

    Однако хаски меньше по размеру и имеют много отличий от волков. Еще одна собака, очень похожая на волка, — аляскинский маламут.

    Обе эти породы часто ошибочно принимают за волков, а некоторые люди даже задаются вопросом, действительно ли они одомашнены.

    Ниже приведен список других пород собак, которые очень похожи на волков и поэтому могут считаться наиболее близкими к волкам по внешнему виду.

    Самоед

    Хотя эта порода намного меньше волка, их все равно можно считать похожими на волков. У них короткие и заостренные уши с длинными мордами. Самоедов до сих пор используют в России для тягловых упряжек и оленеводов. Эта собака также имеет схожую генетику с волками.

    Сибирский хаски

    Эта северная порода собак происходит из Сибири, где она используется для буксировки упряжек.Сибирский хаски похож на волка как по внешнему виду, так и по генетике. Стоит отметить, что сибирский волк отличается от сибирского хаски, хотя многие путают это.

    Басенджи

    Басенджи имеет небольшое сходство со своими предками-волками и является охотничьей собакой из Африки. У него заостренные уши, длинная морда и сходство с серым волком. Эта собака также генетически похожа на волка, и вы можете увидеть некоторое сходство между их мордами.

    Сиба-ину

    Эта порода представляет собой небольшую японскую собаку, но в ней можно заметить небольшое сходство с волками.Они охотятся на кроликов и птиц, что также придает им сходство с волками. Кроме того, их ДНК также похожа. Хотя сиба-ину может быть маленьким, он очень похож на своих предков-волков.

    Аляскинский маламут

    Подобно хаски, эта порода, пожалуй, наиболее близка к волкам по внешнему виду. Отчасти это связано с тем, что их генетический состав все еще невероятно похож на их предков-волков.

    Собаки, наиболее близкие к волкам по ДНК

    Ученые собрали данные и ДНК 1000 собак 85 различных пород.Проанализировав данные, они обнаружили, что четыре собаки были ближе всего к волкам в отношении их ДНК. Этими породами были шиба-ину, чау-чау, акита и аляскинский маламут.

    Интересно отметить, что хаски в этом списке нет. Это показывает, что собака не обязательно должна быть похожа на волка, чтобы обязательно быть близкой к волкам в отношении их ДНК.

    Ниже приведен список еще нескольких пород собак, наиболее близких к волкам по ДНК и генетике.

    Ши-тцу

    Эта маленькая собака декадентского вида, внешне не похожая на волка.Тем не менее, ши-тцу — одна из самых близких пород собак, связанных с волками в отношении их генетики.

    Пекинес

    Опять же, эта болонка совсем не похожа на волка и очень спокойна и любвеобильна. Однако по своему генетическому составу они очень близки к волкам.

    Лхаса Апсо

    Лхаса Апсо используются в качестве сторожевых псов для буддийских монастырей в Тибете, откуда происходит порода. Эта собака очень маленькая и пушистая. Несмотря на это, их ДНК очень похожа на волчью.

    Тибетский терьер

    Подобно лхаса апсо, эта собака родом из Тибета. Эта собака не настоящий терьер; однако, поскольку они содержались как чистокровные собаки более 2000 лет в их родной стране. Несмотря на это, его ДНК очень похожа на серых волков.

    Салюки

    Хотя салюки больше, чем другие собаки, которых мы рассматривали в этом списке, они намного стройнее и менее мускулисты, чем волк. У них длинные морды, но на этом сходство во внешности заканчивается.

    Салюки часто считают древнейшей из существующих пород собак, датируемой 10 000 лет до нашей эры. Древнее наскальное искусство указывает на то, что это действительно так. Поскольку эта собака считается древнейшей породой, вполне логично, что они невероятно близки к своим предкам-волкам.

    Резюме

    Есть много собак, которые похожи на своих предков-волков как внешне, так и внешне. С породами, похожими на волков, нетрудно поверить, что их ДНК все еще очень похожа.

    Однако трудно поверить, что многие породы, такие как лхаса апсо или чау-чау, до сих пор похожи на волков в отношении их ДНК.

    Стандартный немецкий шпиц | Лаборатория ветеринарной генетики

    Ключевые слова для поиска

    Разновидность — Любой -АльпакаБифалоТолсторогБизонВерблюдКотСкотКойотСобакаОселЛосьКозаЛошадьЛамаМул ОленьПако-викунаСвиньяКрасный оленьСеверный оленьОвцаВодяной буйвол Белохвостый оленьВолкЯк

    Порода — Любой -AbyssinianAfghan HoundAfrican PygmyAfrican ShorthairAfricanisAfrikanerAidiAinu DogAiredale TerrierAkbash DogAkhal TekeAkita: Американский typeAkita: Смесь, OtherAkita: Японский typeAkita: UnregisteredAlaskan HuskyAlaskan Кли KaiAlaskan MalamuteAlaskan Sled DogAlpineAlpine DachsbrackeAlpine IbexAlpine LynxAlpine, MiniatureAMB / AMBORAmerican Bandogge MastiffAmerican голубой гасконец HoundAmerican BobtailAmerican BulldogAmerican BullyAmerican CurlAmerican DuallyAmerican Эскимо, Эскимо MiniatureAmerican , СтандартныйАмериканский эскимосский, ИгрушечныйАмериканский фоксхаундАмериканский морской кабанАмериканский голый терьерАмериканский хайлендАмериканский лайнбекАмериканский длинношерстныйАмериканский мамонтовый джекАмериканский молочный девонАмериканский миниатюрныйАмериканский питбультерьерАмериканский короткошерстныйАмериканский спортивный коньАмериканский спортивный пониАмериканский стаффордширский терьерАмериканский теплокровныйАмериканский водяной спаниельАмериканский жесткошерстныйАнатолийская овчаркаАндадураАндалузскийанг.NubianAnglo-Francais де Moyen VenerieAnglo-Francais де Петит VenerieAngoraAngusAngus, LowlineAngus, MidlineAnkole-WatusiAppalachian SinglefootAppaloosaAppendixAppenzellerArabianArdennesAriegeoisArmantArriadorAryan MolossusAsian Leopard CatAsian ShorthairAubracAussiedoodleAustralian Браун GoatAustralian крупного рогатого скота DogAustralian CobberdogAustralian Внутренние DogAustralian KelpieAustralian LabradoodleAustralian Melaan Австралийский Миниатюрный GoatAustralian MistAustralian ShepherdAustralian Пастыря, MiniatureAustralian Stock HorseAustralian TerrierAustrian Black & Tan HoundAustrian PinscherAustrian Shorthaired PinscherAustrian Гладкошёрстная гончаяЭйрширЭйршир КроссАзавакAztecaAzulBabydoll SouthdownBaden-WurttembergBalancerBali Street DogBalineseBambinoBarbados Blackbelly SheepBarbetBarockpintoBaroque PintoBasenjiBashkir CurlyBasque SheepdogБассет Артезианский НормандскийБассет Блю де ГасконьБассет Маунтин Фов де БретаньБассет Оргл Коло Баварский Баварский Баварский Баварский Баварский Баварский Баварский Баварский Баварский nBedlington TerrierBeefmasterBelgianBelgian BlueBelgian GriffonBelgian LaekenoisBelgian MalinoisBelgian MastiffBelgian SheepdogBelgian Спорт HorseBelgian TervurenBelgian WarmbloodBelted GallowayBengalBergamascoBerger де Пиренеи, Smooth MuzzledBerger дю LanguedocBerger PicardBerner LaufhundBerner NeiderlaufhundBernese гора Кизил BlackBichon FriseBiewerBiewer TerrierBiewer Йоркширский TerrierBiewer, BiroBig HornBillyBirmanBisonBlack & Tan CoonhoundBlack Forest HoundBlack HerefordBlack MaximizerBlack Рот CurBlack Русский TerrierBlack Welsh MtBlonde d’AquitaineBloodhoundBlue LacyBluetick CoonhoundBoerBologneseBombayBorder CollieBorder колли Приграничное LeicesterBorder TerrierBorzoiBosnian Roughhaired HoundBoston TerrierBourbonnaisBouvier Des ArdennesBouvier Des FlandresBoxerBoykin SpanielBracco ItalianoBrahmanBrandenburgBrangusBraque d’AuvergneBraque де l’AriègeBraque дю BourbonnaisBraque DupuyBraque Francais де Гранде TailleBraque Francais де Петит TailleBraque Сен-GermainBr aunviehBrazilian TerrierBretonBriardBriquet Griffon VendeenBristolBritish длинношерстная ShorthairBritish Спорт HorseBritish Пятнистый PonyBritish WhiteBrittanyBroholmerBrown SwissBrown Швейцарский CrossBruno Jura LaufhundBrussels GriffonBucking HorseBueLingoBull TerrierBulldogBullmastiffBurchell в ZebraBurmeseBurmillaCa Де BestierCaballo Депортиво ла SillaCairn TerrierCalifornia RedCalifornia SpangledCamarillo WhiteCanaan DogCanadian CurCanadian Eskimo DogCanadian HorseCanadian WarmbloodCanadienneCanadienne CrossCane CorsoCanis lupusCardigan Welsh CorgiCarolina DogCaspian HorseCatahoula Leopard DogCatalan SheepdogCaucasian OvcharkaCavalier Кинг Чарльз SpanielCB Romanesc КарпатинСреднеазиатская овчаркаЧески ФусекЧески ТерьерЦейлонШантийиЧепменс ЗебраШаролеШароле КроссChart PolskiШартрёЧоссиГепардЧесапик Бэй РетриверШевиотЧианинаЧианина КроссШьен д’АртуаШьен Франсэ Блан и НуарЧьен Франсэ Блан и ОранжЧиен Франсэ Блан и ТриколорЧихуахуаЧилийская ЛошадьC hinese CrestedChinese Foo DogChinookChortajChow ChowCimarron UruguayoCirneco dell’EtnaCleveland BayClumber SpanielClun ForestClydesdaleCob NormandCockapooCocker спаниель, AmericanCocker спаниель, Неизвестный VarietyColdblooded TrotterCollieColorado RangerColorpoint ShorthairColumbiaComtoisConnemara PonyContinental WarmbloodCook Остров Feral DogCoopworthCormoCornish RexCorridaleCorrienteCosta риканского Пасо-де-HorseCotentinCoton TulearCotswoldCoyoteCream DraftCriolloCroatian SheepdogCrossbredCurlyCurly покрытием RetrieverCymricCzech WolfdogCzechoslovakian VlcakDachshundDahomeyDales PonyDalmatianDandie динмонт TerrierDanish BroholmerDanish WarmbloodDanish / Swedish FarmdogDenmark FeistDeutsch KooikerDeutsch-DrahthaarDeutsche BrackeDeutscher WachtelhundDeutsches ReitponyDeutsches SportpferdDevonDevon RexDexterDexter CrossDingoDoberman PinscherDogo Аргентинский догДог де БордоДомашняя длинношерстнаяДомашняя рысьДомашняя среднешерстнаяДомашняя короткошерстнаяDon SphynxDonkey, Ass, BurroDorperDorsetDraft CrossDrentse Patrij shondDreverDunkerDutch Belted CattleDutch Belted CrossDutch Harness HorseDutch MalinoisDutch Shepherd, LonghairedDutch овчарка, RoughhairedDutch овчарка, ShorthairedDutch SmoushondDutch WarmbloodEast Европейский ShepherdEast Сибирский LaikaEgyptian MauEnglish BulldogEnglish Кокер SpanielEnglish CoonhoundEnglish FoxhoundEnglish MastiffEnglish SetterEnglish ShepherdEnglish Springer SpanielEnglish Игрушка SpanielEnglish Игрушка TerrierEntlebucherEpagneul Bleu де PicardieEpagneul BretonEpagneul FrancaisEpagneul PicardEpagneul Pont-AudemerEstonian HoundEstrela Mountain DogEurasianEuropean BurmeseEuropean ShorthairExmoor PonyExotic LonghairExotic ShorthairExperimentalFalabellaFarm CollieFaux FriesianFell HoundFell PonyFell SheepdogField SpanielFila BrasileiroFinnFinnhorseFinnish HoundFinnish LapphundFinnish SpitzFire FriesianFlat покрытием RetrieverFleckviehFlorida CrackerFoldexFoxFox терьер, SmoothFox терьер, WireFrederiksborgFrench BulldogFrench Warmblood «Selle Francais» FriesianFriesian CrossFriesi SporthorseGalgo EspanolGallowayGasconGelbviehGeoffroy CatGeorgian GrandeGerman DrahthaarGerman Hunt TerrierGerman LonghairGerman длинноволосого PointerGerman PinscherGerman RexGerman езда PonyGerman SheeppoodleGerman ShepherdGerman короткошерстная PointerGerman Wirehaired PointerGerman WolfspitzGiant Немецкий SpitzGiant SchnauzerGirGlen из Imaal TerrierGloucestershire Старый SpotsGolden GuernseyGolden RetrieverGoldendoodleGordon SetterGotland PonyGr Ang-Fr Триколор HoundGr Ang-Fr W & B HoundGr Ang-Fr W & O HoundGrade LaManchaGrade SaanenGrand англо-FrancaisGrand Бассет гриффон VendeenGrand Bleu де GascogneGrand гасконец-SaintongeoisGrand Griffon VendeenGreat DaneGreat PyreneesGreater Swiss Mountain DogGreek HarehoundGreek SheepdogGreenland DogGrevy в ZebraGreyhoundGriffon Bleu De GascogneGriffon фовизма де BretagneGriffon NivernaisGuernseyGuernsey CrossGulf побережье NativeGypsianGypsy CobGypsy VannerHackney HorseHackney PonyHaflingerHaldenstovareHalf AndalusianHalf ArabianHalf-MarchadorHamiltonstovar eHampshireHanoverianHanoverian HoundHarlequin PinscherHarrierHartmann в ZebraHavana BrownHavana SilkHavaneseHawaiian Пои DogHeading DogHeck TarpanHerefordHertha PointerHessenHibridoHighland FoldHighland LynxHighland PonyHighland StraightHighlanderHimalayanHog IslandHolsteinHolstein CrossHolsteinerHorned DorsetHovawartHuntawayHygenhundIberian WarmbloodIbizan HoundIceland DogIceland PonyIcelandicIcelandicIcelandic HorseIdaho пастбищами PigIle де FranceImperial наследия HorseInca Голая DogInternational Спорт PonyInuit Sled DogInuit ездовая MixIrish DraughtIrish HunterIrish Red & White SetterIrish SetterIrish TerrierIrish воды SpanielIrish WolfhoundIslandsk FarehundIstrian Гончая, гладкошерстнаяИстрийская гончая, жесткошерстнаяИтальянская борзаяИтальянская гончаяДжек-рассел-терьерJacobJämtgetЯпонский бобтейлЯпонский хинЯпонский шпицЯпонский терьерJavaneseJersey CrossJindo DogJungle CurlJura NeiderlaufhundKai DogKalahari RedKallblodstravareKangal DogKangar DogKarakachanelKarakulKarakul gKarelo-финский LaikaKatahdinKayo InuKeeshondKentucky Mountain HorseKerryKerry BeagleKerry Синий TerrierKerry Bog PonyKerry CrossKhao ManeeKiangKiger MustangKikoKinderKing ShepherdKintamani DogsKishuKnabstrupperKomondorKooikerhondjeKoolieKoratKorean Немецкий ShepherdKraski OvcarKromfohrlanderKulanKunekuneKurilean бобтейл LonghairKurilean бобтейл ShorthairKuvaszKyi ЛЕОЛА ManchaLa Манча, MiniatureLa PermLabradoodleLabrador RetrieverLabxGoldenLaekenseLagotto RomagnoloLakeland TerrierLamaleseLancashire HeelerLandseerLapinporokoiraLapponian HerderLarge Черный HogLarge MunsterlanderLarge Испанский HoundLatvian HoundLatvian WarmbloodLeicester LongwoolLeonbergerLeopard CurLeopard HoundLevesqueLhasa ApsoLimousin LincolnLionLipizzanerLithuanian HoundLlewellin SetterLonghornLowchenLundehundLurcherLusitanoLuzerner LaufhundLuzerner NeiderlaufhundLykoiMagyar AgarMaine CoonMaine-AnjouMajestic Tree HoundMalteseManchester TerrierManchester Terrier, ToyMandalayMangalargaMangalarga MarchadorMangalitsaManxMarc higianaMaremma SheepdogMaremma SheepdogMarkhorMarotaMastiffMatthes Lion HoundMcNabMeishanMexican Спорт HorseMi-KiMiddle Азиатского OwtcharkaMilking Девон CrossMilking ShorthornMilking Shorthorn CrossMini HerefordMini-Mid JerseysMiniature American ShepherdMiniature Bull TerrierMiniature GoldendoodleMiniature HighlandMiniature HorseMiniature JerseyMiniature PinscherMiniature Silky Обморок GoatMiniature ZebuMissouri Fox TrotterMohave BobMongolian Внутреннего HorseMontbeliardeMontdaleMontenegrin Mountain HoundMorabMorgan HorseMoriesianMoroccan BarbMoscow длинноволосой Игрушка TerrierMoscow WatchdogMountain CurMudiMuleMullins FeistMunchkinMurray GreyMustangMyotonicNambiNapoleonNational Показать ЛошадьИндейская собакаАборигенная тайская кошкаНавахо-чурроНеаполитанский мастифНебелунгНева-маскарадНью-Форест-пониНью-Гвинейская поющая собакаНьюфаундлендНьюфаундленд-пониНигерийский карликНокотаНорфолк-терьерНорикерНормандНормандНоррботтенспетсНорф-Американская овчаркаНорт-Американ ТракенерНортестерли Хаулинг ЛайкаНорвеги BuhundNorwegian ElkhoundNorwegian Elkhound, BlackNorwegian Fjord HorseNorwegian лес CatNorwegian LundehundNorwegian NordlandNorwegian RedNorwegian Красный CrossNorwich TerrierNova Scotia Duck Толлинговая RetrieverNubianNubian IbexNubian, MiniatureNuwbyOberhasliOberhasli, MiniatureOcicatOjos AzulesOld Датский Bird DogOld Английский SheepdogOlde Английский BulldoggeOldenburgOnagerOriental LonghairOriental ShorthairOtherOtterhoundOuessantOwczarek PodhalanskiOxfordPaint HorsePallas в CatPapillonParson Рассел TerrierPaso FinoPatterdale TerrierPekingesePembroke Welsh CorgiPercheronPerdiguero де BurgosPerdiguero NavarroPerdiguero PortuguesoPerformance Horse Int ‘lPerro de Pastor MallorquinPerro de Presa CanarioPerro de Presa MallorquinPersianPersian CrossPersian IbexПеруанская голая собакаPeruvian HorsePeruvian Inca OrchidPeterbaldPetit Basset Griffon VendeenPetit Bleu de GascognePetit Bleu de GascognePetit BrabanconPetit Gascon-SaintongeoisPetit Griffon Bleu de GascognePhalenePharaohu Hound Кси BobPlott HoundPodenco CanarioPodengo Portugueso GrandePodengo Portugueso MedioPodengo Portugueso Pequeno, SmoothPodengo Portugueso Pequeno, WirehairedPointerPoitevinPoitouPolish HoundPolish низменность SheepdogPolish Owczarek PodhalanskiPolish WarmbloodPoll HighlandPolled HerefordPolski Owczarek NizinnyPolypayPomeranianPomskyPony из AmericasPoodle, MiniaturePoodle, StandardPoodle, ToyPoongsan DogPorcelainePortuguese Крупный рогатый скот DogPortuguese PointerPortuguese SheepdogPortuguese воды DogPosavac HoundPrager RatterProvencePrzewalskiPudelpointerPugPuliPumiPura Раза EspañolaPygmyPygoraPyreneanPyrenean MastiffPyrenean ShepherdQuarter HorseRacking HorseRafeiro до АлентежуРагамаффинРэгдоллРамбуйеРэндалл ЛайнбэкКрысиный терьерКрасно-белыйКрасно-белый сеттерКрасный ангусRed PollRed Wattle HogRedbone HoundRheinlandRheinland Pfaltz-SaarSelle FrançaisSilesian HorseWest Caucasian TurAffenpinscherMountain Pleasure HorseRhenish German ColdbloodRhodesian RidgebackRidgebackRo CrossRocky Cross Romagnola CrossRomeldale / CVMRomneyRottweilerRumanian SheepdogRussell TerrierRussian BlueRussian Арлекин HoundRussian HoundRussian OrloffRussian самоед LaikaRussian SpanielRussian WarmbloodRussian WhiteRusskiy ToyRusso-Европейский LaikaSaanenSaanen, MiniatureSaarlooswolfhondSableSable, MiniatureSabuesos Espanol де MonteSabuesos Espanol LebreroSaddlebredSafariSaint BernardSaint Hubert Jura LaufhundSaint Использование SpanielSalersSaltilloSalukiSamoyedSan Клементе IslandSanshu DogSanta CruzSantal HoundSapsareeSarplaninacSavannaSavannah CatSaxon-Тюрингии ColdbloodSchapendoesSchillerstovareSchipperkeSchnauzer, MiniatureSchnauzer, StandardSchweizer LaufhundSchweizer NeiderlaufhundScottish БлэкфейсСкоттиш-коллиСкоттиш-дирхаундСкоттиш-фолдСкоттиш-хайлендСкоттиш-хайленд-пониСкоттиш-страйтСкоттиш-терьерСилихэм-терьерSegugio Italiano a Pelo ForteSegugio Italiano a Pelo RasoСелкирк-рексСеппала Сибирская ездовая собакаСербская гончаяСербская трехцветная гончаяСервалШарпейШетландский пониШетландские острова SheepdogShiba InuShih TzuShikokuShiloh Shepherd DogShiloh Shepherd, ISSAShireShire CrossbredShorthornShropshireSiameseSiberian CatSiberian HuskySilken WindhoundSilky TerrierSillo ArgentinoSimbrahSimmentalSingapuraSingle-Footing HorseSkye TerrierSloughiSlovak CuvacSlovakian WH Указывая DogSmalandsstovareSmall немецкого SpitzSmall MunsterlanderSnowshoeSoaySoft Мелованного пшеничного TerrierSomaliSouth Африканского бурбуль MastiffSouth Немецкого ColdbloodSouth Русского OvcharkaSouth Россия Степной HoundSouthdownSpanishSpanish AlanoSpanish BarbSpanish Heritage HorseSpanish MastiffSpanish MustangSpanish воду DogSphynxSpinone ItalianoSporthorseSporting Lucas TerrierSpotted Седло ЛошадьСпрингер-спаниельШри-ланкийская собакаSt.CroixStabyhounStaffordshire Bull TerrierStandard Немецкий SpitzStandardbredStephens StockStichelhaarStrellufstoverStumpy хвост крупного рогатого скота DogStyrian Roughhaired Горный HoundSudanese DogSuffolkSuffolk PunchSuiz BuSuphalakSussex SpanielSwedish ElkhoundSwedish LapphundSwedish VallhundSwedish WarmbloodTahltan Медведь DogTaiganTamaskanTargheeTarpanTasyTeddy Рузвельт TerrierTelomianTengger DogTennessee RexTennessee Walking HorseTenterfield TerrierTexelThaiThai BurmeseThai RidgebackThailand PonyThornburg FeistThoroughbredTibetan MastiffTibetan SpanielTibetan TerrierTiffanyToggenburgTonkineseTosa InuTosa KenToy Fox TerrierToy Немецкий SpitzToybobToygerTrakehnerTranscaspian UrialTransylvanian гончая, LongTransylvanian гончая, ShortTreeing FeistTreeing Tennessee BrindleTreeing Walker CoonhoundTrochaTrocha y GalopeTrote y GalopeTunisTurbo FriesianТурецкая ангораТурецкая дикая собакаТурецкая борзаяТурецкий ванТирольская гончаяTyroler BrackeUnknownUruguayan CriolloValais BlacknoseVasgotaspetsVirginia WarmbloodVizsla Volpino ItalianoWagyuWalker CoonhoundWarlanderWeimaranerWelsh HoundWelsh PonyWelsh PonyWelsh SheepdogWelsh Springer SpanielWelsh TerrierWeser Эмс PoniesWest хайленд уайт TerrierWest сибирская LaikaWestfalenWestphalian DachsbrackeWetterhounWhippetWhippet, LonghairedWhippet, длинноволосого CrossWhite ParkWhite ShepherdWild HorseWiltshire HornWirehaired Указывая GriffonWirehaired VizslaWolfWolf HybridWorking DogX-Bred CoonhoundXoloitzcuintliXoloitzcuintli, ToyYork ChocolateYorkshire TerrierZangersheide

    Тип теста — Любой -Цвет шерсти и/или типЗдоровьеПроизводственный признакРодительский/генетический маркерДругое

    Вариант сайта сплайсинга ОСА2 у немецких шпицев с глазо-кожным альбинизмом

    Abstract

    Мы исследовали семью немецких шпицев, в которой от вязки черного самца с белой самкой родилось три щенка с неожиданным светло-коричневым окрасом шерсти, слегка пигментированными губами и носом и голубыми глазами.Комбинированный анализ сцепления и гомозиготности, основанный на полностью пенетрантном моногенном аутосомно-рецессивном типе наследования, выявил критический интервал в 15 Мб на хромосоме 3. Мы получили данные о последовательностях всего генома от одной больной собаки, трех волков и 188 контрольных собак. Фильтрация частных вариантов выявила один вариант с прогнозируемым высоким влиянием в критическом интервале в LOC100855460 (XM_005618224.1:c.377+2T>G LT844587.1:c.-45+2T>G). Вариант прекрасно сегрегировался с фенотипом в семье.Мы генотипировали 181 контрольную собаку с нормальной пигментацией из разных пород, включая 22 неродственных немецких шпица, все из которых были гомозиготными по дикому типу. Сравнительный анализ последовательностей показал, что LOC100855460 на самом деле представляет собой 5’-конец собачьего гена OCA2 . Сборка эталонного генома CanFam 3.1 неверна и отделяет первые два экзона от остальных экзонов гена OCA2 . Мы амплифицировали фрагмент кДНК OCA2 собаки с помощью ОТ-ПЦР и определили правильную полноразмерную последовательность мРНК (LT844587.1). Варианты гена OCA2 вызывают глазокожный альбинизм типа 2 (OCA2) у людей, конъюнктивит у мышей и сходные фенотипы у кукурузных змей, медаки и мексиканской пещерной тетры. Таким образом, мы заключаем, что наблюдаемый глазокожный альбинизм у немецких шпицев, скорее всего, вызван идентифицированным вариантом в 5′-сайте сплайсинга первого интрона собачьего гена ОСА2 .

    Образец цитирования: Caduff M, Bauer A, Jagannathan V, Leeb T (2017) OCA2 вариант сайта сплайсинга у немецких шпицев с глазокожным альбинизмом.ПЛОС ОДИН 12(10): е0185944. https://doi.org/10.1371/journal.pone.0185944

    Редактор: Claire Wade, Сиднейский университет, факультет ветеринарии, АВСТРАЛИЯ

    Получено: 11 июля 2017 г.; Принято: 21 сентября 2017 г.; Опубликовано: 3 октября 2017 г.

    Авторские права: © 2017 Caduff et al. Это статья с открытым доступом, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

    Доступность данных: Данные о последовательностях полного генома 192 собак доступны в Европейском архиве нуклеотидов (ENA). Полный список инвентарных номеров приведен в таблице S4. Полноразмерная последовательность мРНК ОСА2 собаки доступна под регистрационным номером LT844587 в ENA.

    Финансирование: Это исследование было поддержано грантами Швейцарского национального научного фонда (CRSII3_160738; http://www.snf.ch) и Фонда Альберта-Хейма (№ 105; http://www.albert-heim-stiftung.ch/). Спонсоры не участвовали в разработке исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

    Конкурирующие интересы: Авторы заявили об отсутствии конкурирующих интересов.

    Введение

    Глазокожный альбинизм (ГКА) обобщает группу наследственных нарушений синтеза меланина, характеризующихся гипопигментацией кожи, волос и глаз [1]. Шесть из семи типов ГКА человека отнесены к вариантам в определенном гене: ГКА1 ( TYR ), ГКА2 ( ОСА2 ), ГКА3 ( TYRP1 ), ГКА4 ( SLC45A2 ), ГКА6 ( SLC24A5) и ОСА7 ( LRMDA ) [1,2].Варианты ОСА2 вызывают ОСА2 у людей (OMIM #203200) и покраснение глаз у мышей [3]. Сообщалось о 150 человеческих и 100 мышиных вариантах OCA2 [4,5]. Кроме того, амеланизм у кукурузных змей и альбинизм у медаки и мексиканской пещерной тетры также вызываются вариантами ОСА2 [6–8].

    Фенотип у пациентов с ОСА2 варьирует. Количество остаточного кожного пигмента варьируется и обычно увеличивается с возрастом. Цвет радужной оболочки также вариабелен.Как и при других типах глазокожного альбинизма, могут наблюдаться гипопигментация радужной оболочки, приводящая к ее прозрачности, снижение пигментации пигментного эпителия сетчатки, фовеальная гипоплазия, снижение остроты зрения, аномалии рефракции, а иногда и степень нарушения цветового зрения. Фенотип человеческого OCA2 является наиболее распространенным типом OCA у африканцев и также называется коричневым OCA у африканцев [1,2].

    Человеческий ген OCA2 охватывает 380 т.п.о. на хромосоме 15, а основная изоформа транскрипта содержит 24 экзона [9].Меланосомный трансмембранный белок ОСА2, ранее называвшийся Р-белком, является предполагаемым переносчиком анионов с 12 трансмембранными доменами. ОСА2 играет роль в биогенезе меланосом, регулировании pH меланосом и синтезе эумеланина [3,5,10,11]. Он необходим для нормального процессинга и транспорта других меланосомных белков, таких как TYR и TYRP1 [1].

    Цель настоящего исследования состояла в том, чтобы раскрыть молекулярную генетику фенотипа глазокожного альбинизма в семье немецких шпицев.

    Результаты

    Характеристика фенотипа

    Нашему вниманию было представлено семейство немецких шпицев породы Гигантский шпиц, где от вязки черного кобеля и белой суки был получен помет с шестью щенками. Три щенка имели ожидаемую черную окраску, а остальные три щенка, два кобеля и одна сука, были светло-коричневого окраса, что не могло быть объяснено генотипами известных локусов основной окраски (рис. 1). У отца, матери и здоровых однопометников были темные носы и глаза от коричневого до янтарного цвета, в то время как у трех коричневых щенков были светлые губы и носы и голубые глаза, которые с возрастом стали зелеными.Появились расширенные зрачки красноватого цвета. Окрас шерсти с возрастом несколько потемнел. Владелец сообщил, что больные щенки щурились при ярком солнечном свете (светобоязнь) и с трудом воспринимали сигналы руками при ярком солнечном свете. В отчетах заводчиков указывалось, что собаки с подобным фенотипом ранее были замечены в этой линии собак. Эти данные свидетельствовали о моногенном аутосомно-рецессивном типе наследования.

    Рис. 1. Фенотипы окраски шерсти исследуемого семейства гигантских шпицев.

    (A) Белая мать и черный отец помета. ( B) Фотографии двух больных щенков и одного здорового брата или сестры слева в возрасте одной недели. (C, E) Больная собака GS103 с зелеными глазами и светлым носом в возрасте 4 и 5,5 месяцев соответственно. (D, F) Больная собака GS104 в возрасте 4 и 7 месяцев соответственно.

    https://doi.org/10.1371/journal.pone.0185944.g001

    Картирование причинного очага

    Мы генотипировали всех членов семейства на чипе Illumina canineHD SNP и использовали комбинированный подход по сцеплению и гомозиготности в семье с ее шестью потомками.Был проведен параметрический анализ сцепления, предполагающий полностью пенетрантное, моногенное аутосомно-рецессивное наследование признака. Этот анализ выявил 10 сегментов размером ≥ 1 Мб, которые показали положительные оценки LOD (таблица S1). Картирование аутозиготности у трех пораженных собак дало три гомозиготных участка с общими аллелями (таблица S2). Только один сегмент генома, Chr3: 28 747 944–43 731 542, показал как сцепление, так и гомозиготность (рис. 2).

    Рис. 2. Комбинированное картирование сцепления и гомозиготности.

    Мы провели параметрический анализ сцепления рецессивного признака у всех восьми членов семьи и картирование гомозиготности у трех пораженных немецких шпицев.Десять сцепленных сегментов генома обозначены оранжевым цветом, а три гомозиготных сегмента с общими аллелями — красным. Только одна область на хромосоме 3 показала как сцепление, так и гомозиготность и считалась критическим интервалом (стрелка). В частности, эта область ~ 15 Мб соответствовала Chr3: 28 747 944–43 731 542 (сборка CanFam 3.1).

    https://doi.org/10.1371/journal.pone.0185944.g002

    Идентификация возбудителя

    Мы повторно секвенировали весь геном одной пораженной собаки и назвали одиночные нуклеотиды, а также индел-варианты относительно эталонного генома здорового боксера (CanFam 3.1). Генотипы пораженных немецких шпицев были дополнительно сопоставлены с геномами 188 собак различных пород и тремя геномами волков, которые были секвенированы в ходе других исследований. Мы предположили, что причинный вариант должен полностью отсутствовать во всех других геномах, кроме немецкого шпица с глазокожным альбинизмом.

    В пределах критического интервала этот процесс фильтрации дал только один единственный частный вариант с предсказанным влиянием на ген, кодирующий белок (таблица 1).Этот вариант затрагивал 5’-сайт сплайсинга одиночного интрона LOC100855460 (Chr3:31,715,704A>C; XM_005618224.1:c.377+2T>G).

    Мы подтвердили вариант сайта сплайсинга с помощью секвенирования по Сэнгеру и генотипировали 8 членов семьи, 22 неродственных немецких шпица (8 гигантских шпицев, 7 миниатюрных шпицев и 7 померанских шпицев) и 159 контрольных собак различных других пород (рис. 3А). Генотипы в этом варианте показали идеальную косегрегацию с фенотипом (рис. 3В). Ни одна из 181 контрольной собаки с нормальной пигментацией не имела мутантного аллеля (таблица S3).

    Рис. 3. Генотипы помета немецких шпицев.

    (A) Хроматограммы секвенирования по Сэнгеру иллюстрируют последовательности гомозиготной собаки дикого типа, гетерозиготного носителя и гомозиготной пораженной собаки. Вариант заменил незаменимый тимин в положении +2 5′-сайта сплайсинга на гуанин. (B) Родословная помета гигантских шпицев. Генотипы в варианте сайта сплайсинга показывают ожидаемую косегрегацию с фенотипом.

    https://дои.org/10.1371/journal.pone.0185944.g003

    LOC100855460 представляет собой 5’-конец гена ОСА2

    Поскольку вариант сайта сплайсинга LOC100855460 представляет собой наш лучший кандидатный причинный вариант для наблюдаемого фенотипа глазо-кожного альбинизма, мы выполнили поиск BLAST с LOC100855460 для выявления предполагаемых гомологов у других видов млекопитающих. Эти анализы показали, что LOC100855460 соответствует первым двум экзонам человеческого гена OCA2 .Текущая неправильная аннотация гена собаки в этом регионе, скорее всего, связана с ошибкой сборки в эталонном геноме CanFam3.1, который содержит сегмент геномной ДНК ~ 300 т.п.н. в перевернутой ориентации (рис. 4).

    Рис. 4. Точечный график Chr15 человека: 27 500 001–29 000 000 против Chr собаки 3: 31 500 001–33 000 000.

    Человеческий ген OCA2 охватывает 380 т.п.н. Точечный график показывает, что эталонная последовательность собаки примерно на 300 т.п.н. инвертирована по отношению к последовательности человека из-за ошибки сборки в текущей версии CanFam 3.1 сборка. Из-за этой ошибки сборки первые два экзона собачьего гена OCA2 в настоящее время имеют неправильную ориентацию и аннотированы как LOC100855460 .

    https://doi.org/10.1371/journal.pone.0185944.g004

    Экспериментальное подтверждение предполагаемой структуры гена OCA2

    собаки

    Мы подтвердили предполагаемую ошибку сборки генома с помощью ПЦР дальнего действия на геномной ДНК. Затем мы разработали пару праймеров для ОТ-ПЦР с прямым праймером в LOC100855460 и обратным праймером в собачьем гене OCA2 .RT-PCR и последующее секвенирование продукта по Сэнгеру показали, что LOC100855460 и OCA2 действительно являются частями одного и того же транскрипта.

    На основании результатов ОТ-ПЦР и общедоступных данных секвенирования РНК мы определили полноразмерную последовательность мРНК ОСА2 собаки и отправили ее в Европейский архив нуклеотидов (номер доступа LT844587.1). Этот транскрипт содержит открытую рамку считывания из 2532 нуклеотидов, кодирующих белок из 844 аминокислот, который демонстрирует 83% идентичность меланосомному трансмембранному белку OCA2 человека из 838 аминокислот, изоформа 1 (NP_000266.2). Большинство различий в последовательностях расположены в первых 180 остатках на N-конце.

    На основании нашей пересмотренной полноразмерной последовательности ОСА2 собак, вариант-кандидат, причинный для глазокожного альбинизма у собак, должен быть обозначен как ОСА2 :LT844587.1:c.-45+2T>G. Он влияет на 5′-сайт сплайсинга первого интрона собачьего гена ОСА2 .

    Обсуждение

    В этом исследовании мы определили вариант сайта сплайсинга в собачьем гене OCA2 как наиболее вероятную причину глазокожного фенотипа альбинизма у собак.Есть два основных аргумента в пользу заявленной причинно-следственной связи: вариант влияет на консервативный динуклеотид GT в 5′-сайте сплайсинга интрона AG-GT [12]. Такое геномное изменение несовместимо с нормальным процессом сплайсинга и, по прогнозам, приведет к потере функции мутантного гена. Во-вторых, мы предоставили доказательства того, что вариант сайта сплайсинга влияет на первый интрон гена ОСА2 собаки . Функциональная роль этого гена в пигментации хорошо известна, и многочисленные генетические варианты у людей, мышей и других позвоночных приводят к фенотипам кожно-глазного альбинизма, которые очень похожи на фенотипы, наблюдаемые у собак в этом исследовании [3–8]; (OMIA 000202–7994, OMIA 000202–94885).Сообщалось, что мутантные аллели ОСА2 в основном блокируют синтез эумеланина с менее выраженным влиянием на синтез феомеланина [4]. У людей с ОСА2 наблюдается резкое снижение эумеланина в коже, глазах и волосах, что приводит к кремовому цвету кожи и желто-соломенным волосам, которые темнеют с возрастом [13]. Меланосомы неправильной формы наблюдались у p-дефицитных мышей [14], а измерения содержания меланина выявили значительное снижение уровней эумеланина, но не феомеланина [15,16]. Экспрессия ОСА2 была обнаружена только в черной спинной, но не в желтой брюшной части черно-подпалых мышей ( a t /a t ), тогда как она присутствовала в вентральной черной коже неагути ( a/a ) мышей [3].Эти результаты согласуются с фенотипом собак с дефицитом OCA2 в настоящем исследовании. Основываясь на их генотипах в других локусах окраски шерсти, можно было ожидать, что три пораженные собаки будут черными из-за присутствия доминантного аллеля K B ( E/e ; A w /a ; K B /k y ; B/B 9005 , B/B , 6/0-90 D/B , .Неясно, представляет ли остаточный светло-коричневый пигмент у пораженных собак смесь эумеланина и феомеланина или это аномальный меланин коричневатого цвета.

    Накопление пигмента с возрастом было описано у людей, больных ОСА2 [17], и наблюдалось у больных собак, когда цвет глаз менялся с голубого на светло-зеленый, а цвет шерсти темнел. Наблюдаемая светобоязнь и полупрозрачность радужной оболочки у пораженных собак согласуются с описанием нарушений зрения у людей с ОСА [1,18].Из-за светобоязни таких собак не следует специально разводить, и в будущем следует избегать вязок носитель х носитель.

    Это исследование освещает текущее состояние геномных ресурсов у собак и многих других видов домашних животных. Хотя было показано, что секвенирование всего генома представляет собой мощную технологию, когда дело доходит до выявления причинных вариантов менделевских признаков, анализу биоинформационных данных препятствуют несовершенные эталонные сборки генома и аннотации генов.С текущими ресурсами требуется значительный объем интерпретации данных экспертами-людьми. Можно ожидать, что в будущем, с появлением более качественных эталонных геномов, подобные анализы станут проще и будут включать в себя большую степень автоматизированного анализа данных.

    В заключение, мы идентифицировали вариант в консервативном 5′-сайте сплайсинга первого интрона собачьего гена OCA2 как наиболее вероятную причину наблюдаемого глазокожного альбинизма в семействе гигантских шпицев.Это облегчит генетическое тестирование, чтобы избежать случайного разведения других щенков с этим фенотипом. Наша работа выявила ошибку сборки в сборке CanFam3.1, и мы предоставляем пересмотренную полноразмерную последовательность кДНК ОСА2 собаки .

    Материалы и методы

    Заявление об этике

    Все эксперименты на животных проводились в соответствии с местным законодательством. Собаки в этом исследовании были обследованы с согласия их владельцев. Исследование было одобрено «Кантональным комитетом по экспериментам на животных» (кантон Берн; разрешения 75/16 и 38/17).

    Образцы ДНК и генотипирование

    Мы получили образцы крови с ЭДТА от обоих родителей и всех 6 щенков помета немецкого шпица (разновидность гигантского шпица). Мы выделили геномную ДНК с помощью набора ДНК цельной крови Maxwell RSC и инструмента Maxwell RSC (Promega). Генотипирование двух родителей и шести однопометников было выполнено с помощью GeneSeek/Neogen на чипе Illumina CanineHD BeadChip, содержащем 220 853 маркера. Мы также использовали 181 контрольный образец собачьей ДНК из биобанка Vetsuisse, который был собран в ходе других проектов.

    Анализ сцепления и картирование гомозиготности

    Данные о генотипах 8 членов семьи использовались для параметрического анализа сцепления. Уровень звонков был > 95% для всех собак. С помощью PLINK v 1.07 [19] были удалены неинформативные маркеры, расположенные на половых хромосомах или отсутствующие у любой из 8 собак, имеющие ошибки Менделя или частоту минорного аллеля <0,3125. Окончательный сокращенный набор данных содержал 34 356 маркеров. Модель аутосомно-рецессивного наследования с полной пенетрантностью, частота аллеля болезни равна 0.5 и программное обеспечение Merlin [20] применяли для проверки сцепления. Интервалы с положительными показателями LOD и α = 1 были сохранены для дальнейшего анализа.

    Для картирования гомозиготности использовались данные о генотипах трех пораженных собак. Были исключены маркеры, отсутствующие в одном из трех случаев, маркеры на половых хромосомах и маркеры с менделевскими ошибками в семье. С помощью опций «гомозиг» и «гомозиг-группа» в PLINK были идентифицированы расширенные области гомозиготности > 1 Мб. Гомозиготные интервалы в трех случаях пересекались со сцепленными интервалами для определения минимальных критических интервалов.

    Полногеномное секвенирование

    Свободная от ПЦР библиотека Illumina TruSeq с размером вставки 350 п.н. была получена от одной больной собаки (GS104). Библиотека была секвенирована с 32-кратным охватом генома с использованием считывания 2 x 150 п.н. на приборе Illumina HiSeq 3000. Варианты с одним нуклеотидом и малым инделем относительно сборки эталонного генома собак CanFam3.1 называли, как описано [21]. Варианты, частные для GS104, были идентифицированы путем фильтрации вариантов, которые содержались в геномах 3 волков и 188 контрольных собак, секвенированных для предыдущих проектов (таблица S4).Частные варианты были расставлены по приоритетам в соответствии с их прогнозируемым воздействием с использованием SNPeff [22] и выпуска аннотаций NCBI 104.

    Секвенирование по Сэнгеру

    Мы использовали секвенирование по Сэнгеру, чтобы подтвердить результаты секвенирования Illumina и провести целевое генотипирование варианта сайта сплайсинга в LOC100855460 . AmpliTaqGold360Mastermix (Applied Biosystems) и пару праймеров GCTTGGCTTTCCGTGAG (прямой праймер) и CGAAGCTTGTGCTCAATGTC (обратный праймер) использовали для амплификации области с помощью ПЦР.Продукты ПЦР секвенировали непосредственно на капиллярном секвенаторе ABI 3730 (Applied Biosystems) после обработки экзонуклеазой I и щелочной фосфатазой креветок. Обратный праймер использовали в качестве праймера для секвенирования. Мы проанализировали данные о последовательности с помощью Sequencher 5.1 (GeneCodes).

    ПЦР дальнего действия

    ПЦР дальнего действия проводили с использованием пары праймеров GGCAAACTTGGGAGTGGTAA (Chr3:31,659,781–31,659,762) и CCCCCTCAAATAAACCATGA (Chr3:32,346,375–32,346,356) и набора SequalPrep Long PCR (Invitrogen).Фрагменты ПЦР анализировали с использованием FragmentAnalyzer (Advanced Analytical).

    ОТ-ПЦР

    Мы выделили тотальную РНК из биоптата кожи здоровой контрольной собаки с использованием спин-колонок QIAzol и RNeasy в соответствии с рекомендациями производителя (Qiagen). Образцы РНК обрабатывали ДНКазой, не содержащей РНКаз, для удаления загрязнений геномной ДНК. Обратную транскрипцию проводили с использованием праймера oligo-dT и обратной транскриптазы Superscript ® IV в соответствии с рекомендациями производителя (Invitrogen).ПЦР и секвенирование проводили с 2 мкл синтезированной кДНК и парой праймеров TTCTTTCTGGCTGACCTCGT (прямой праймер, ОСА2 экзон 2, Chr3: 31,681,124–31,681,105) и ATGCACCATGACCCTTTCTC (обратный праймер, Ch33, 63, 13, 4 экзонов 4 –32 366 608 и Chr3:32 362 337–32 362 330), используя прямой праймер в качестве праймера для секвенирования. Для определения 5’- и 3’-концов последовательности мРНК OCA2 мы использовали общедоступные данные секвенирования РНК из кожи носа собак (номер доступа к проекту ENA PRJEB14109, образец доступа SAMEA4412813, идентификатор лаборатории LA1666).

    Благодарности

    Авторы хотели бы поблагодарить заводчика Барбару Тушл и нынешних владельцев собак за предоставленные образцы и фотографии, а также за то, что они поделились информацией о родословной своих собак. Авторы также хотели бы поблагодарить Натали Безуше, Мюриэль Франьер и Сабрину Шенк за квалифицированную техническую помощь. Мы благодарим сотрудников Консорциума базы данных биомедицинских вариантов собак (DBVDC), Гаса Агирре, Катрин Андре, Данику Баннаш, Дорин Беккер, Корда Дрогемюллера, Кари Экенштедт, Оливера Формана, Стива Фриденберга, Еву Ферроу, Урса Гигера, Кристофа Хитте, Марджо Хайтонен, Видья Джаганнатан, Тоссо Либ, Ханнес Лохи, Кэтрин Меллерш, Джим Микельсон, Леонардо Мургиано, Анита Обербауэр, Шейла Шмутц, Джеффри Шёнебек, Ким Саммерс, Фрэнк ван Стинбек, Клэр Уэйд за обмен данными о последовательности генома собаки от контрольных собак и волков.Платформа секвенирования следующего поколения и межфакультетское подразделение биоинформатики Бернского университета получили признание за проведение экспериментов по повторному секвенированию всего генома и предоставление высокопроизводительной вычислительной инфраструктуры.

    Каталожные номера

    1. 1. Гронсков К., Эк Дж., Брондум-Нильсен К. Глазокожный альбинизм. Orphanet J Rare Dis. 2007;2: 43. pmid:17980020
    2. 2. Монтолиу Л., Гронсков К., Вей А.Х., Мартинес-Гарсия М., Фернандес А., Арвейлер Б. и др.Увеличение сложности: новые гены и новые виды альбинизма. Пигментно-клеточная меланома Res. 2014; 27: 11–18. пмид:24066960
    3. 3. Ринчик Э.М., Бультман С.Дж., Хорстхемке Б., Ли С.Т., Странк К.М., Спритц Р.А. и соавт. Ген локуса разбавления розовых глаз мыши и глазокожного альбинизма II типа у человека. Природа. 1993; 361: 72–76. пмид:8421497
    4. 4. Мартинес-Гарсия М., Монтолиу Л. Альбинизм в Европе. J Дерматол . 2013; 40: 319–324. пмид:23668539
    5. 5.Блестящий М. Мышиный p (красноглазый разведение) и человеческий P гены, глазо-кожный альбинизм 2 типа (OCA2) и меланосомный рН. Пигментная клетка Res. 2001; 14: 86–93. пмид:11310796
    6. 6. Саенко С.В., Ламичани С., Баррио А.М., Рафати Н., Андерссон Л., Милинкович М.С. Амеланизм у кукурузной змеи связан со вставкой LTR-ретротранспозона в гене ОСА2 . Sci Rep. 2015;5: 17118. pmid:26597053
    7. 7. Фукамачи С., Асакава С., Вакамацу Ю., Симидзу Н., Митани Х., Сима А.Законсервированная функция медака конъюнктивита в синтезе меланина и дивергентная регуляция его транскрипции в гонадах у позвоночных. Генетика. 2004; 168: 1519–1527. пмид:15579703
    8. 8. Protas ME, Hersey C, Kochanek D, Zhou Y, Wilkens H, Jeffery WR, et al. Генетический анализ пещерных рыб показывает молекулярную конвергенцию в эволюции альбинизма. Природа Жене. 2006; 38: 107–111. пмид:16341223
    9. 9. Веб-сайт NCBI Gene, описывающий особенности гена OCA2 человека (аннотация, выпуск 108).https://www.ncbi.nlm.nih.gov/gene/4948.
    10. 10. Роземблат С., Дарем-Пьер Д., Гарднер Дж. М., Накацу Ю., Бриллиант М. Х., Орлоу С. Дж. Идентификация белка меланосомной мембраны, кодируемого геном разбавления конъюнктивита (кожно-глазный альбинизм II типа). Proc Natl Acad Sci USA. 1994; 91: 12071–12075. пмид:79

    11. 11. Хиробе Т. Как регулируются пролиферация и дифференцировка меланоцитов? Пигментно-клеточная меланома Res. 2011; 24: 462–478. пмид:21375698
    12. 12.Бурсет М., Селедцов И.А., Соловьев В.В. SpliceDB: база данных канонических и неканонических сайтов сплайсинга млекопитающих. Нуклеиновые Кислоты Res. 2001; 29: 255–259. пмид:11125105
    13. 13. Манга П., Орлоу С.Дж. Ген розового глаза и молекулярный патогенез тирозиназо-положительного альбинизма (OCA2). J Дерматол. 1999; 26: 738–747. пмид:10635616
    14. 14. Рассел Э.С. Количественное гистологическое исследование пигмента, обнаруженного у мутантов окраса шерсти домовой мыши.IV. Характер эффектов генной замены в пяти основных аллельных рядах. Генетика . 1949; 34: 146–166.
    15. 15. Озэки Х., Ито С., Вакамацу К., Хиробе Т. Химическая характеристика меланинов волос у мышей с различными мутантами цвета шерсти. Джей Инвест Дерматол. 1995; 105: 361–366. пмид:7665913
    16. 16. Prota G, Lamoreux M, Muller J, Kobayashi T, Napolitano A, Vincensi MR, et al. Сравнительный анализ меланинов и меланосом, продуцируемых различными мутантами окраски шерсти. Пигментная ячейка Res . 1995;8: 153–163. пмид:7567792
    17. 17. Кинг Р.А., Крил Д., Арвенка Дж., Окорд А.Н., Виткоп С.Дж. Альбинизм в Нигерии с выделением нового рецессивного глазокожного типа. Клин Жене. 1980; 17: 259–270. пмид:6768477
    18. 18. Ли С.Т., Николлс Р.Д., Банди С., Лаксова Р., Мусарелла М., Спритц Р.А. Мутации гена P при глазо-кожном альбинизме, глазном альбинизме и синдроме Прадера-Вилли плюс альбинизм. N Engl J Med. 1994; 330: 529–534. пмид:8302318
    19. 19.Перселл С., Нил Б., Тодд-Браун К., Томас Л., Феррейра М.А., Бендер Д. и др. PLINK: набор инструментов для полногеномной ассоциации и анализа сцепления на основе популяции. Am J Hum Genet. 2007; 81: 559–575. пмид:17701901
    20. 20. Абеказис Г.Р., Черный С.С., Куксон В.О., Кардон Л.Р. Merlin — быстрый анализ плотных генетических карт с использованием разреженных деревьев потоков генов. Нат Жене. 2002; 30: 97–101. пмид:11731797
    21. 21. Бауэр А., Валук Д.П., Галичет А., Тимм К., Джаганнатан В., Саяр Б.С. и др.Вариант de novo в гене ASPRV1 у собаки с ихтиозом. Генетика PLoS. 2017;13: e1006651. пмид:28249031
    22. 22. Чинголани П., Платтс А., Ван ле Л., Кун М., Нгуен Т., Ван Л. и др. Программа для аннотирования и прогнозирования эффектов однонуклеотидных полиморфизмов SnpEff: SNP в геноме штамма Drosophila melanogaster w1118; изо-2; изо-3. Флай (Остин). 2012;6: 80–92.

    Какая собака генетически наиболее близка к волку? Что тебе нужно знать!

    Все мы знаем, что когда-то лучшим другом человека было дикое существо, стаями бродившее по лесам, лесам и равнинам.Если учесть, что достойный волк связан с упрямым мопсом, может быть довольно дико даже представить, что они являются частью одного и того же вида.

    Итак, какие породы ближе всего к волкам? Ответ может вас удивить.

    7 пород собак, наиболее близких к волкам

    В настоящее время у собак и волков общая ДНК составляет 99,9%. По данным PBS, за последние 150 лет путем целенаправленного скрещивания были созданы разные породы собак, с разным внешним видом, физическими и умственными характеристиками, которые служат маркерами разведения.

    Однако со временем возникли генетические проблемы и другие проблемы, связанные с целенаправленным разведением. Когда-то считалось, что одомашненных собак использовали для охраны скота и других целей. Но вполне возможно, что собаки могли сначала прийти к людям за теплым убежищем и едой.

    Давайте взглянем на породы, которые наиболее тесно связаны со своими двоюродными братьями-волками.

    1. Шиба-ину

    Изображение предоставлено: paigerowe, Shutterstock
    Происхождение: Япония
    Вес: 18-22 фунта
    Высота: 13-17 дюймов
    Цвета: Красный кунжут, черный кунжут, черно-подпалый, кунжут, кремовый, красный
    Темперамент: Уверенный в себе, волевой, ласковый, покладистый

    Внушительный маленький шиба-ину — веселый щенок, который больше похож на лису, чем на волка.Тем не менее, они очень тесно связаны с волками и имеют много общего в поведении. Эти пылкие щенки полны огня и постоянно работают на полном баке.

    Они могут быть немного сложными для начинающих владельцев, так как они, как правило, довольно упрямы. Но они также невероятно полезные щенки с любовью к природе. Всегда проверяя воду, ваш Шиба может также проверить ваше терпение.

    Они очень общительны с членами своей семьи, но могут быть сдержанны с незнакомцами.Они также немного притяжательны и требуют обучения манерам, когда делятся игрушками или возвращают мячи во время принесения.


    2. Чау-чау

    Кредит изображения: Flower_Garden, Shutterstock
    Происхождение: Китай
    Вес: 44-71 фунт
    Высота: 18-22 дюйма
    Цвета: Черный, голубой, палевый, красный, кремовый
    Темперамент: Доминирующий, отчужденный, верный

    Похожая на медведя чау-чау — одна из старейших китайских пород.Его сразу узнают по морщинам, густой шерсти и черному пигментированному языку.

    Чау-чау определенно не для слабонервных. У них очень напористый, даже доминирующий характер с потенциальными проблемами агрессии. Опытные владельцы собак должны хорошо справляться с породой, но они могут не так хорошо работать с новичками.

    Но чау-чау далеко ушли от своего первоначального предназначения пасти и охранять. Тем не менее, они по-прежнему любят защищать свою семью с непоколебимой преданностью.Если у вас есть проблемы с чау-чау, проявляющим агрессию, вам может понадобиться обучение поведению.


    3. Самоеды

    Изображение предоставлено: xxxnik, Pixabay
    Происхождение: Россия
    Вес: 35–66 фунтов
    Высота: 19-24 дюйма
    Цвета: Белый, белый и бисквитный, кремовый
    Темперамент: Игривый, общительный, бдительный, бодрый, дружелюбный

    Самоедская порода очень близка своим диким двоюродным братьям-волкам.Это очень жизнерадостная собачка из семейства шпицев с кучей энергии. Эта порода особенно привязывается к членам своей семьи. Они смотрят на вас как на родного и наслаждаются каждым моментом, проведенным с нашими владельцами.

    Поскольку эта порода очень привязана, они лучше всего чувствуют себя с владельцами, которые не вносят существенных изменений. Покупка или усыновление этой прекрасной собаки означает обязательство на всю ее жизнь.

    Самоед чрезвычайно дружелюбен как с незнакомцами, так и со знакомыми друзьями.Эта красивая белая порода, как правило, очень хорошо ладит с детьми всех возрастов, хотя их энергия может быть довольно большой для детей младше 6 лет.


    4. Акита

    Изображение предоставлено: uadrienn, Pixabay
    Происхождение: Япония
    Вес: 51-86 фунтов
    Высота: 22-27 дюймов
    Цвета: Белый, тигровый, кунжутный, красно-палевый
    Темперамент: Ласковый, верный, отчужденный с незнакомцами

    В целом, акита имеет максимально возможное количество ДНК со своими дикими сородичами, но при этом сами не считаются чистыми волками.Это действительно проявляется в напористом поведении акиты. Многие владельцы, вероятно, могли бы понять, насколько близко они могут быть связаны. Шерсть акиты характерна для холодных температур.

    Акита по своей природе любопытна и предприимчива. Нет ничего необычного в том, что один из них может сбежать из любого вольера. Но кроме этого, акиты довольно тихие, не лают, если на это нет серьезной причины. Из этих собак получаются отличные сторожевые псы, поскольку они, как известно, не уверены в незнакомцах.

    Однако, в случае необходимости, вы можете рассчитывать на их защиту вашего дома.Эти собаки — безжалостно верные существа, заботящиеся только об одном — о благополучии своей семьи.

    Акиты лучше всего подходят для содержания в сельской местности или пригородах с большими задними дворами. Поскольку эти собаки любят бродить и бродить, у вас должно быть место и время, чтобы проводить с ними время. Они также могут быть мастерами побега, и они великолепны, поэтому убедитесь, что ваш забор очень хорошо укреплен.


    5. Сибирский хаски

    Изображение предоставлено: Александр Абросимов, Shutterstock
    Происхождение: Аляска
    Вес: 35-60 фунтов
    Высота: 20–24 дюйма
    Цвета: Белый, черный, серо-белый, соболиный с белым, черно-подпалый, черно-белый, серебристо-серый, серый, рыжий и белый
    Темперамент: Умный, дружелюбный, активный, общительный

    Сибирские хаски тесно связаны с волками, но озадачивают ученых своим совершенно другим поведением.Сибирские хаски, как и волки, склонны к стае. Однако их действия и характеры сильно различаются.

    Сибирские хаски очень предприимчивы и активны. Если их не стимулировать должным образом, у них легко разовьются нервные наклонности или деструктивное поведение. Хаски умеют убегать от природы. Если они закрыты без надлежащих упражнений, они будут хотеть сбежать при каждом удобном случае. С хаски можно много работать

    , но они также могут стать отличными компаньонами для всей семьи.Тем не менее, они обычно лучше всего себя чувствуют в домах, где много места для прогулок и бега. Так что, если вы живете в городской квартире, эта порода может вам не подойти.


    6. Басенджи

    Изображение предоставлено: Никита Тиунов, Shutterstock
    Происхождение: Древний Египет
    Вес: 20-25 фунтов
    Высота: 15-17 дюймов
    Цвета: Черный, тигровый, черно-белый, трехцветный, подпалый, красный
    Темперамент: Тихий, бдительный, резкий, мягкий, игривый, ласковый

    Басенджи — очень древняя порода, восходящая к временам Древнего Египта.Есть предположение, что это могли быть эфиопские волки, а не потомки традиционных серых волков. Если вы взглянете на этот вид волков, довольно легко увидеть заметное сходство.

    Они считаются нелающими собаками Африки, что является огромным плюсом для некоторых людей, предпочитающих меньше вокализации. Но, как и некоторые другие знакомые вам породы, басенджи издают йодль, а не лай, когда общаются, как их дикие предки.

    Басенджи имеют репутацию очень гигиеничных животных, которые часто ухаживают за собой.Это относительно небольшая порода, но с очень худощавым спортивным телосложением. Эти собаки очень общительны с членами своей семьи и очень любопытны к своему окружению.

    Известно, что у этой породы довольно культовый статус. Итак, если вам когда-либо посчастливилось встретить басенджи или владеть им, они, вероятно, оставили след в вашем сердце.


    7. Аляскинский маламут

    Изображение предоставлено: Лилия Кулянионак, Shutterstock
    Происхождение: Северо-Западная Аляска
    Вес: 75-85 фунтов
    Высота: 22-26 дюймов
    Цвета: Серый и белый, тюлень и белый, соболиный и белый, черный и белый, шоколадный и белый, красный и белый
    Темперамент: Верный, веселый, бдительный, игривый

    Аляскинские маламуты, вероятно, не являются шокирующим близким родственником серых волков.С их стандартной окраской и общими чертами вы определенно можете увидеть сходство.

    Аляскинские маламуты очень бдительны, бдительны, из них получаются замечательные сторожевые псы. Но они также чрезвычайно лояльны и преданы семье, а это значит, что они отличные семейные компаньоны.

    Иногда маламуты могут быть немного территориальными, поэтому они могут плохо относиться к незнакомцам, прогулкам или другим домашним животным.

    Зарезервированные природой, эти собаки станут незаменимыми компаньонами в правильном доме.


    Бонус: гибриды волков

    Кредит изображения: Ингрид Пакатс, Shutterstock
    Происхождение: Северная Америка
    Вес: 75-155 фунтов
    Высота: 25-33 дюйма
    Цвета: Серый и белый, тюлень и белый, соболиный и белый, черный и белый, шоколадный и белый, красный и белый
    Темперамент: Верный, веселый, бдительный, игривый
    Гибриды волка

    становятся все более популярными, особенно в Северной Америке.В некоторых штатах действуют различные законы и правила, запрещающие их владение, поскольку многие законодатели до сих пор рассматривают этих существ как диких животных, а не домашних животных.

    Гибриды волка различаются в процентном отношении, когда речь идет о генетике серого волка. В некоторых почти нет волка, в других есть почти все генетические связи. А некоторые даже пытаются выдать настоящих волчат за гибридов, где владение волками является незаконным.

    Гибриды волка должны рассматриваться только опытными владельцами собак, которые много знают о дикой версии ваших собачьих приятелей.Одомашнивание и селекционное разведение сделали собак, которых мы знаем, очень совместимыми с нашей жизнью. Гибриды волков — совсем другое дело.

    Если вам нужно разрешение или другой юридический документ на владение гибридом волка в вашем штате, обязательно соблюдайте местные законы.

    Можете ли вы владеть чистыми волками?

    Идея завести собственного волчонка может быть очень привлекательной. Если у вас есть любовь к происхождению ваших собак, вы можете почувствовать, что это будет очень полезным опытом.Однако владение волком сильно отличается от владения домашней собакой.

    Хотя некоторые чистокровные собаки очень похожи на волков, они все же далеко ушли от своих первобытных корней. Если у вас нет большого опыта общения с дикой природой и вы не держите волка на благо животного, лучше всего держать этих красавцев в дикой природе, где им и место.

    Однако, если вам интересно, вот еще немного информации о владении волками, защите, разрешениях и сохранении от Международного центра волков.

    Собаки, похожие на волков

    Из-за любви многих заводчиков к диким волкам многие породы были созданы, чтобы выглядеть как эти свирепые красавцы. Хотя они могут быть не так тесно связаны, как другие, о которых мы упоминали, они, безусловно, имеют визуальную привлекательность.

    Некоторые из этих пород включают:

    Заключение

    Итак, теперь вы видите, насколько близки наши собачьи спутники диким волкам. Удивительно, как эволюционировали разные породы и что между ними остается неизменным.

    Одно можно сказать наверняка, приручение волков навсегда изменило жизнь людей. Где бы мы были без наших пушистых друзей?


    Авторы избранных изображений: Петра Гёшель, Pixabay

    Волчий шпиц Кеесхонд Описание породы. Описание породы кеесхонд, здоровье собаки и ее стоимость. Обучение и выставка




    сб, 31.12.1898 — 12:00

    Ожидаемая продолжительность жизни

    Вольфшпиц — Самеа крупная собака Из всей группы немецких спа.В Голландии этих собак называют кеесхонда. Заводчики Кеесхондов утверждают, что эти собаки относятся к разным породам, что они отличаются друг от друга, у них разная История и характеры. Однако Международная федерация кино также считает, что вольфшпица и кеесхонда — это одни и те же собаки под разными именами, для них существует единый стандарт. Заводчики Кеесхондов предполагают, что их зрачки более пушистые, чем у вольщпиц, что формат у них более квадратный, а история происхождения совсем другая.Но мы придерживаемся официальной позиции ICF. Поэтому речь пойдет о породе «вольфшпиц/кеесхонд».

    История породы

    Предками голландских кеесхондов были датские баржевые собаки, которые наводняли корабли вместе с матросами, истребляя с кораблей крыс. Таких собак стали называть Кешонда в 1781 году. В это время в Голландии вспыхнуло восстание нынешнего короля Вильгельма Оранжевого. Корнелиус де Гизелир стал вождем революции, а его собака — символом этой революции.Конечно, это был кеесхонд. После этого кеесхонды оказались на грани исчезновения, от них стали избавляться. Однако к концу 19 века популярность и численность собак этой породы стали возрождаться. В 1933 году любители этих собак создали свой клуб и разработали стандарт породы. Однако в 1899 г. в Германии комбинация «немецкий шпиц» выработала стандарты для всех спа разного размера и окраса. Международная федерация кинологов поддержала Германию и официально признала немецкую версию стандарта для самого большого курорта.Сегодня эти собаки чрезвычайно популярны во многих странах мира.

    Внешний вид

    Вольфшпиц – собака среднего размера, квадратного формата. У него клиновидная голова с широким черепом. Морда короткая, сужается к переносице. Нос среднего размера, округлой формы, черный. Губы плотно прилегающие, также черные. Глаза среднего размера, овальной формы, темно-карие. Уши стоячие, высоко поставленные, маленькие, треугольной формы. Шея средней длины; Вокруг нее шерсть образует пышную и густую гриву.Поясница сильная, короткая и широкая. Грудь глубокая, хорошо развитая. Живот в меру подтягивается. Хвост высоко посажен, пьян в кольцо, лежит на спине, очень пушистый, покрыт густой шерстью. Конечности прямые и крепкие, параллельны друг другу. Линии маленькие, округлой формы с черными когтями и подушечками. Шерсть длинная, прямая с густым хлопком и густым подбородком. На задних конечностях образует пышные «штаны». Цвет-серый цвет. Морда и уши мечты. На воротнике, в области холки и на задних конечностях шерсть более светлая.

    Характер и темперамент

    Волчьи шпицы-кеесхонды очень дружелюбные и забавные собаки. Они внимательны к своему хозяину, господа ко всем членам семьи, в которой живут. На прогулках беспокоен, а дома достаточно спокоен и терпелив. Люблю играть с детьми. Также не прочь повеселиться с другими питомцами, они хорошо относятся даже к кошкам. Сервис обычно очень серьезный, всегда на чеку. Особенно любят волноваться. Эти собаки очень верные и преданные, ради счастья своего хозяина готовы на все.

    Здоровье и болезнь

    Волчьи шипы-кеешонды могут наследовать болезни сердца, а также эпилепсию. Чтобы этого не произошло, обязательно изучите родословную щенка перед его приобретением. Риск этих заболеваний должен быть минимальным. Также не стоит переливать питомца, есть риск ожирения. Обязательно обеспечивайте ему хорошие физические нагрузки и длительные прогулки. У остальных обычно проблем со здоровьем нет, у них крепкое здоровье, среди них много долгожителей.

    Независимо от того, где вы живете, в квартире или в большом частном доме за городом, вы можете смело приобретать Вольфшфетц Кешондов. Эти собаки приспособятся к любым условиям жизни, и везде будут чувствовать себя комфортно. Пушистая, достаточно длинная с густым и плотным подшерстком вольфшпица-кеесхонда нуждается в регулярном уходе. Такую шерсть нужно подсчитывать хотя бы раз в неделю. Для этого можно использовать щетку с длинными металлическими тканями. В период смены кровоточивости, которая возникает два раза в год, нужно пользоваться прицелом, а сама процедура гораздо чаще, можно даже каждый день.Помните, что вольфшпиц кеесхонд должен выглядеть естественно, шерсть этих собак нельзя стричь. Представители этой породы чистоплотны, редко пачкаются, в регулярном купании не нуждаются. В случае чего лучше удалить грязь мягкой щеткой, либо использовать для чистки сухой шампунь. Ведь если часто купать такую ​​собаку, структура ее шерсти может нарушиться. Не забывайте периодически чистить уши и периодически чистить зубы, промывать глаза отваром ромашки, а также каждый месяц стричь ему когти.

    Дрессерный, Тренутанна

    Представители этой породы очень умные и сообразительные собаки, они довольно легко обучаются, очень любопытны, поэтому с удовольствием будут выполнять новые трюки. В Голландии кеесхонды в основном выполняют функцию домашних компаньонов. Поэтому ими занимаются в основном коллективы, которые, по большей части, развлекали людей, а не приносили им пользы. Кеесхонда – собаки, пользующиеся популярностью на выставках в обществе. Это так называемые общественные собаки.А вот немецкую волчью шпицу разводят совершенно по-другому. В Германии представители этой породы считаются серьезными сторожевыми псами. На занятиях их учат беречь имущество и близких, а ненужных людей не держать рядом, если нет воли хозяина. Эти собаки любят пластилин. Поэтому только от вас зависит, кого вы будете выращивать: кеесхонду или вольфшпица.

    Для собак этой породы корм идеально подходит в пищу. Этот вид питания имеет множество преимуществ: — Вы экономите собственное время, которое могли бы потратить на приготовление пищи из натуральных продуктов; — Специализированный корм полностью учитывает все потребности собак той или иной породы, он сбалансирован и содержит все необходимые витамины и минералы; — Не вызывает аллергических реакций.Однако чтобы корм действительно благотворно влиял на здоровье и самочувствие вашего питомца, он должен быть качественным, без химических добавок, красителей и консервантов. Основным ингредиентом в составе корма должно быть мясо. Не забывайте, что чистая вода В миске вашего питомца должна быть 24 часа в сутки.

    21. Январь 2015.

    Наверняка многие из нас слышали о такой породе, как Кешунд. Немецкие собаки – самые крупные представители семейства шпицев. Именно о Wolfspice Keeshonde пойдет речь в нашей статье.

    История породы

    Немецкий вольфшпиц — самый крупный представитель обширного семейства вертелов. Специалисты утверждают, что порода относится к древнейшим в Европе. Немецкие представители признают отдельную точку зрения. Но в Нидерландах порода получила другое название – кеесхонд. Поэтому в мире собака известна как вольфшпиц (кеесхонд).

    Считается, что предками голландских собак были барзованные датские собаки, которые путешествовали на кораблях вместе с моряками.Их использовали для уничтожения таких вредителей, как крысы. В 18 веке в Голландии произошло восстание против правящего короля. Возглавлял движение Корнелиуса де Гизелара. А его верный пес стал настоящим символом революции. Это был не кто иной, как представитель породы вольфшпиц (кеесхонд).

    Прошло не так много времени, а животные оказались практически на грани вымирания. Но в конце девятнадцатого века собаки вновь обрели популярность, что привело к увеличению размеров породы.Знатоки этого вида даже создали свой клуб, а потом вывели стандарт породы. А вот в Германии в 1899 году объединение любителей шпицев выработало свои стандарты для представителей всех размеров и окрасов. Федерация кинологов в начинаниях поддержала немецкую сторону, поэтому были приняты стандарты, разработанные Германией. С тех пор прошло много времени, и порода стала очень популярной во многих других странах.

    Стандарт породы

    Описание волчьей косы (кеесхонды) следует начать с указания на его внушительные размеры.В холке животное достигает 45 сантиметров. Но порода представляет интерес не столько своими размерами, сколько невероятно гармоничным телосложением. Вес собак колеблется в пределах 25-30 килограммов. Животные привлекают внимание роем необычно торчащей шерсти, маленькими ушками и лисами. Хвост животного также плотно покрыт шерстью и имеет вид плотного кольца, прижатого к спине.

    Для вольфшпица (кеесхонда), фото которого приведено в статье, характерно наличие вокруг глаз пятен, имеющих миндалевидную форму и коричневый цвет.Морда животного имеет такое выражение, что кажется, что собака все время улыбается. Этот факт и послужил причиной появления такого прозвища, как «улыбчивый голландец». Порода вольфшпиц (кеесхонд) – обладательница жесткой и длинной шерсти, имеющей свойство свисать. Особенно это заметно вокруг шеи, где формируется роскошная грива. А в районе задних лап мех образует плотные штаны. Короткий ворс у собак только на голове.

    Цветное животное

    Волчьи косы могут иметь только волчью окраску, о чем свидетельствует их название.Шерсть может быть любого серого оттенка. Кроме того, на морде животного должна присутствовать маска черного цвета. В темный цвет окрашены уши животного и кончик хвоста. А вот шпильки, как правило, очень светлые или кремовые. Но при этом стоит отметить, что никакого родства с волками животные не имеют.

    Характер представителей породы

    Вольфшпиц (кеесхонд) – невероятно подвижная и энергичная собака, обладающая живым темпераментом. Она независима и уверена в себе и своих силах.Горшки очень привязаны к хозяевам и умеют ревновать. А вот к незнакомцам шпицы относятся с невероятной осторожностью. Они проявляют разумное недоверие и подозрительность.

    Вольфшпиц (кеесхонд), фото которого приведено в статье, иногда может быть сварливым с незнакомыми собратьями. Однако со всеми домашними животными у собак все в порядке. Начинать воспитание животного стоит с раннего детства. При этом нужно проявить твердость и терпение.

    Немецкий вольфшпиц кеесхонд тонко чувствует своих хозяев.Он без слов может представить, чего от него хотят люди. Поэтому можно наблюдать картину, когда пес прячется в укромном уголке, если человеку в этот момент не до него. Животное просто не хочет мешать хозяину.

    Вообще стоит сказать, что щенков вольфшпица кеесхонда можно смело сравнивать с ураганом. Их нужно достаточно долго выгуливать, давать соответствующие физические нагрузки, при первой же возможности стоит вывезти животное на природу, где оно может возбудиться.Сформировавшись, собаки становятся более спокойными и уравновешенными. Но при этом сохраняют свой игривый и живой нрав. Собаки-уборщики легко поддаются дрессировке. Так, например, в России впервые животные попали в качестве артистов цирка. Животные часто принимают участие в соревнованиях, их используют в караульно-розыскной службе. А также для психотерапевтической работы, так как на контакт с психотерапевтом пациенты идут в присутствии животного.

    Характеристика породы

    Описание породы кеесхонд вольфшпиц будет неполным, если не упомянуть, что животное прекрасно подходит для семьи.Кашпо становятся лучшими компаньонами для своих владельцев. Часто используются животные в качестве сторожевых псов. Кроме того, косы способствовали выпадению скотины. Небольшая группа животных справлялась со стадом, защищая его от хищников. Также стоит отметить, что кеесхонды очень привязаны к своему дому. Если говорить об отзывах владельцев волкодавов (кеесхондов), то люди характеризуют животных с лучшей стороны, отмечая их доброту. Кроме того, собаки не доставляют хлопот своим хозяевам. Животным не свойственна агрессия, равнодушие или капризность.

    Но в то же время собаки очень любознательны, они будут стараться попасть в любой щелчок в доме. Будучи маленькими, животные требуют пристального внимания, ведь с ними нужно играть. Только заботливые хозяева смогут вырастить веселого и дружелюбного друга. Очень важной характеристикой породы является ее чистоплотность. Кеесхонды моют лапы, как кошки.

    Немецкий вольфшпиц кеесхонд (фото приведено в статье) может жить в обычной квартире. Но при этом стоит помнить о физических нагрузках на животное и регулярных длительных прогулках.С одной стороны уход за таким питомцем несложен, но с другой не стоит забывать о его густой шерсти, которую необходимо регулярно чистить. Для процедуры необходимо приобрести специальную щетку. Кроме того, такой уход полезен для животного, так как в процессе расчесывания вы одновременно массируете кожу ПСА, тем самым улучшая кровоток. Купание питомца применяют редко, ориентируясь на степень загрязнения шерсти. Частые банные процедуры могут сломать защитный слой покровов.А вот резать не рекомендуется. У кобелей белье только раз в год, а у сук — два. Весь период длится около трех-четырех недель.

    В остальном косы неприхотливы. Они здоровы и имеют крепкое телосложение. Животные могут жить до 17 лет. Однако необходимо помнить, что их нельзя переворачивать, так как собаки невероятно набирают вес.

    Кормление питомцев

    Вопрос питания для кеесхондов очень важен, так как они склонны к полноте.Поэтому владельцам необходимо тщательно следить за рационом своего питомца. Кормить животное можно качественными сухими кормами, предназначенными для данного типа собак. Кормление должно проводиться два раза в день. Следует следовать инструкциям на упаковке, чтобы выбрать правильное количество корма.

    К вопросу нужно подходить с умом. Опытные собаководы рекомендуют выполнять простые правила:

    1. Между приемами пищи должен быть строгий промежуток времени.
    2. После еды нельзя оставлять миску, ее лучше спрятать.
    3. Но емкость с водой всегда должна быть наготове, чтобы собака могла утолить жажду.
    4. Если вы кормите ПСА готовыми кормами, то не стоит предлагать ему еду со своего стола.
    5. Если животное отказывается от еды, то нужно выявить причину. Так как часто это может быть признаком заболевания.
    6. Собака должна приучать команды к еде, чтобы во время прогулок найденная еда не становилась ее пищей. В вашей команде животное должно выйти из находки.
    7. Применение корма КОС необходимо при его отсутствии.

    Сообщение

    Вольфшпицу можно кормить и домашней едой. Но это займет у вас гораздо больше времени, ведь его придется готовить отдельно для питомца. Собаку нельзя кормить чем-то со своего стола. Для нее следует готовить отдельное питание. Единственным недостатком такого питания является то, что крайне сложно составить сбалансированное меню, которое обеспечит питомца всем необходимым. В этом случае можно проконсультироваться с опытными заводчиками или ветеринаром.

    Дрессировка собак

    Достаточно обучить питомца.Ведь пес очень умный, интеллигентный. Она всегда стремится предугадать желания своего обладателя. И поэтому она очень быстро учится всяким трюкам.

    За достигнутые успехи животное необходимо поощрять словами и лакомствами. Лучший стимул для PSA — тренер по улыбке. Стоит помнить, что собаки прекрасно реагируют даже на интонацию голоса, поэтому крики и агрессия лишают желания заниматься. К процессу обучения нужно подходить как к игре.Играя, собака будет стремиться сделать все, что от нее хочет хозяин.

    Кеесхонда вполне может быть публичным псами. Все зависит от их воспитания. Из животного можно сделать верного сторожевого пса, милого компаньона или собаку для выставок. Все зависит от того, какие цели вы ставите перед собой. Животное вдруг, как пластилин, нужно только правильно его использовать.

    Стоимость щенка

    Волщпицы относятся к достаточно дорогим породам. Стоимость щенка колеблется примерно в пределах 15-40 тысяч рублей.Во многом это зависит от наград родителей, племенных или выставочных перспектив и возможностей песика.

    Болезни

    Как мы уже упоминали, порода отличается крепким здоровьем. Заболеваний, которым подвержены волчьи шипы, практически нет. Достаточно редко, могут возникать сбои в работе щитовидной или надпочечников, эпилепсия или болезни сердца.

    Прививки

    Волчьи вертелы нуждаются в прививках. Но прежде чем вы решите их сделать, вам нужно знать, какие из них уже были сделаны и когда была сделана последняя дегельминтация.Впервые антигельминтные препараты дают щенкам в возрасте трех месяцев. Это связано с тем, что может быть внутриутробное инфицирование. Процедуру вторично проводят не ранее чем через 10-15 дней.

    Прививать можно только абсолютно здоровое животное. Для того чтобы понять, готов ли ваш питомец к процедуре, необходимо в течение трех дней измерять температуру. Норма для щенков – до 39,3 градусов, а для взрослых собак – до 38,5 градусов.

    В перечень обязательных прививок входят прививки от парагриппа, чумы плотоядных, лептоспироза, бешенства и инфекционного гепатита.Современные ветеринары могут предложить вам как поливалентные, так и моновалентные вакцины. Отличие их в том, что одни формируют иммунитет от одного заболевания, а другие – сразу от нескольких. Схему вакцинации должен индивидуально разработать врач.

    Серый кеесхонд Вольфшпиц – самая большая разновидность немецкого спа. Несмотря на «волчье» название, собаки этой породы напоминают волка только умом, окрасом и подозрительностью к постороннему. В остальном это очень добродушные и игривые животные, способные на проявления любви и преданности хозяину и его семье.

    Краткое описание породы:

    — Ожидаемая продолжительность жизни: 12-16 лет;
    — Рост: Кобель — 48-55 см, сука — 43-50 см;
    — вес: кобели — 27-30 кг; сука — 25-28 кг;
    – это энергичные собаки, любящие проводить часы на свежем воздухе;
    За шерстью волкодавов необходим регулярный уход, особенно в период линьки;
    имеют крепкое здоровье, изредка отмечается склонность к наследственным заболеваниям: эпилепсия, ожирение, дисплазия тазобедренных суставов, сбои в работе сердечно-сосудистой системы и щитовидной железы, вывих коленного сустава Кашечка;
    — Воспитание и дрессировка не доставят особых хлопот, ведь собаки этой породы понимают, чего хотят, и быстро запоминают команды;
    — Бдительные парики, крикливые охранники, но не защитники, т.к. не склонны к агрессии и редко кусаются;
    — вольфшпицы могут приспособиться к любым условиям содержания, поэтому их можно содержать как в квартире или доме, так и на улице;
    – хорошо чувствуют себя на морозе, но плохо переносят сильную жару;
    Со всеми членами семьи и домашними животными Волчьи шпицы легко найдут общий язык и с удовольствием проведут с ними время.


    Как и у всех немецких спа, предками вольфшпицев являются торфяные и болотные (озерные) собаки. Уже в XVI веке, благодаря отваге и выносливости, собак этой породы стали использовать в качестве охранников небольших барж, из-за чего их прозвали «баржами». Также они успешно справлялись с охотой на корабельных крыс, выпасом стада овец и коров. Со временем волчьи шипы стали отличными компаньонами и домашними питомцами.

    Первой родиной волчьего шипа стала Германия, где он и получил свое официальное название За внешнее сходство с волком.Вторая страна происхождения породы – Голландия, где ее впервые назвали кеесхонд.

    В стандартах FCI и РКФ кеесхонд — второе название породы немецкий волчий шпиц. Американский клуб собаководства считает, что это две разные породы. Эта точка зрения связана с тем, что голландский представитель несколько ниже немецкого, его исгефульная шерсть мягче на ощупь, а морда немного шире.

    Если с происхождением названия «вольфшпиц» все понятно, то о появлении кеесхонда спорят до сих пор.Некоторые специалисты связывают его со словом Case — «кейс», потому что компактные собаки легко помещаются в боксы, расположенные на баржах. Другие считают, что название породы собак Keeschond появилось благодаря двум голландским словам: Kaas — Сыр, Hond — собака. В Нидерландах этих животных используют, как и прежде, для охраны стад коров.

    Человек не вмешивается в работу природы, а дает ей оценку
    В отличие от других немецких спа, селекционная работа практически не коснулась вольфов.Поэтому современные представители породы очень похожи на предков.

    Все собаки имеют квадратный формат тела, тело биттеров немного длиннее тела кобелей. Немного вытянутое лицо с черным носиком, переход ото лба к лицу с едва заметными, чуть раскосными маленькими глазами, высокие и близко расположенные друг к другу треугольные уши. Прикус может быть как ножницеобразным, так и прямым, с полным набором ровных белых зубов – 42 шт. Спина ровная, круп не выпуклый и широкий, грудь объемная, лапы хорошо развиты физически.Движения собаки свободные, пружинящие и прямолинейные.

    Вольфшпиц

    похож на пушистое облачко, благодаря мягкому удлиненному подшерстку, хорошо опушённому хвосту, лежащему на спине, и «штанишкам», доходящим до середины лапы. Остальная шерсть несколько короче и жестче на ощупь. Собаки очень любят белье, поэтому не рекомендуется запускать аллергию.

    Стандартом

    Вольфспаны допускается только зонарно-серый окрас шерсти, у основания светлее, чем на конце. Однако в мире есть представители пород с другими окрасами: серые с белыми пятнами, белые, кремовые, рыжие.

    Стоимость собаки зависит от ее соответствия стандартным параметрам и цели покупки. Например, щенков кеесхонда с мягкой изойкой или вольфрамом с небольшими дефектами можно приобрести за 700-900 долларов. Это собаки пет-класса – pet pets. Щенки брид-класса, пригодные для племенного разведения, стоят 1200-2000 долларов. Выставки шоу-класса самые дорогие: от 2200 до 3000 долларов.

    Компаньон для энергичных людей


    Вольфшпиц идеально подходит для людей, ведущих активный образ жизни.Выносливости собаки может позавидовать любой. Он легко составит компанию на велосипедной прогулке или утренней пробежке. С животными можно заниматься катанием на лыжах и фризби — играми с летающей тарелкой. Многие владельцы участвуют с питомцами в Agillati — управляемом беге с препятствиями.

    Хотя толфпиты и любят играть в часы с детьми, не рекомендуется заводить их маленьким членам семьи. Как слишком занятые люди. Собаке необходимо много внимания, ежедневные длительные прогулки, различные физические нагрузки.

    Вынужденное одиночество и замкнутое пространство негативно сказываются на психике животного, выводя его из себя и делая неуправляемым.Кроме того, в отсутствие хозяина питомец начнет себя развлекать, разрушать квартиру и портить имущество.

    Преданный, но шумный охранник


    Громкий лай может быть как достоинством, так и недостатком вольфшпица. Для охранников вмененной территории Лай — неотъемлемая часть работы. Бдительная собака всегда сообщит о подозрительном предмете. Однако не каждый выдержит звонкий питомец, способный реагировать на все подозрительные звуки.
    Вольфшпицы преданы своему хозяину, готовы смело «зангбавить» любую опасность, но не более того.

    В характере собак этой породы отсутствует агрессия, они не способны нападать, задерживать, защищаться. Сделать из них телохранителей не получится.

    А вот Вольфы используются в розыскной службе, как путники для слухопротезирования, в сеансах канистровых комиссий — лечение людей с психическими или физическими отклонениями.

    Несмотря на врожденную подозрительность к незнакомцу, вольфшпица легко сходится с другими питомцами, а при своевременной социализации — с другими.В целом эти собаки не конфликтны и не любят лезть в драки.

    От базовых команд до спецподготовки


    Вольфшпиц

    с удовольствием обрадует хозяина, поэтому хорошо поддается воспитанию и дрессировке. Благодаря природному интеллекту они быстро понимают, что от них требуется, и запоминают множество команд. Не обязательно проверять нервную систему и служебные качества собаки, но можно пройти с ней специальную подготовку для службы охраны.

    Единственное, с чем может столкнуться владелец вольфшпица – рассеянное внимание животного из-за желания поиграть или побегать.Собака сможет сосредоточиться на дрессировке, если проводить занятия в игровой форме с элементами устного и «вкусного» похвалообразования.

    Если вам понравилась статья, нажмите «Мне нравится» и поделитесь ею с друзьями.

    Нет похожих сообщений.

    Древняя порода собак выжила в климатических условиях Север считается кеесхондом. Эта красота ловится взглядом. Красивое тело, великолепная шерсть и заплаканные глаза – отличительные признаки породы.

    История появления породы

    шпиц относятся к древнейшим породам собак, живущим рядом с человеком.Кеесхонда недавно объединили в единую породу с вольф-шпицем. Кеесхонд считается разновидностью собаки «немецкий шпиц». Цеесхонд родился в Германии, прародителем были барри из Дании, получившие название благодаря постоянному размещению на баржах на Рейне. От подобных собак выведена порода вольфшпиц, долгое время считавшаяся отдельной, но в 1998 году объединенная с породным кеесхондом.

    Интересен факт: порода собак кеесхонд может быть названа по имени собаки, сопровождавшей Корпелиуса де Гиссера в революции 1781 года — Кес, или Кейс.Принц Оранж и его приближенные называли бунтовщиков бродягами, бездомными, что по-голландски звучало как «Геза». Это прозвище приклеилось к собаке, что было невероятно, как бунтари. Собака стала настоящим символом свободы. Однако по завершении восстания власти приказали уничтожить всех собак этой породы и подобных им животных. Только благодаря бане баронессы Харденбрек Порода вновь появилась на свет. На полное восстановление породы и возвращение собаки к жизни женщина потратила 10 лет.

    Первые кеесхонды появились в Нидерландах в 16 веке. Предками считаются собаки, живущие в северных районах. Прошло много времени, а порода не меняется, лица не теряет. Основные отличительные признаки, унаследованные от диких сородичей:

    • Средние размеры;
    • Крепкое здоровье;
    • Выносливость;
    • Неприхотлив в питании.

    Первые кеесхонды сразу понравились человеку и стали дружить, начав охранять лодки или сопровождая хозяина на баржах, охраняя добро.Собака внимательно посмотрела на хозяина, пытаясь понять человека, научилась распознавать его настроение. Всегда уйдет в укромный уголок, если друг занят или не хочет общаться.

    Официальное название породы кеесхонд было получено в 1926 году, через 7 лет был открыт первый клуб любителей. Конец XX века ознаменовался широким распространением собак.

    Описание породы

    Характеристики породы:

    Небольшие размеры, компактная собака, с гармонично сложенным телом, покрытым вертикально стоящей густой длинной шерстью — первое впечатление от представителей кеесхондской породы.Во внешнем виде наблюдается некоторое легкое сходство с диким зверем. Мордочка похожа на лисью, окрас зверька напоминает волчий. Шерстяной чехол серого или близких оттенков. На морде вокруг глаз два небольших пятнышка — своеобразные характерные очки, уши черные, как кончик хвоста.

    Тело покрыто длинной шерстью, жесткой и густой. Длина волосяного покрова достигает 15 см. Кажется, что шерсть встала дыбом, но это знакомое состояние. Особенно пушистой выглядит грива на шее, на загнутом в кольцо хвосте и штаны на лапках.На голове шерсть короткая. Между ними заметна длинная шерсть, густой густой пей, от светлого до нежно-кремового, заставляющий каждый волосок стоять вертикально.

    Глаза Кеесхонды пытливые и внимательные. Взгляд бойкий, похожий на характер питомца. Форма продолговатая, размер средний. Посажены глаза породы немного насмешливо, кажутся распущенными и озорными. Недаром породу называют улыбающимся голландцем.

    Маленькие ушки напоминают прямоугольные треугольники, постоянно вздернутые вверх.Уши посажены высоко.

    Представители кеесхондской породы не отличаются крупными размерами. В кумире кобели 43 — 45 м, суки чуть меньше. Удивительным кажется строгое соотношение высоты в холке к длине туловища. Значение всегда постоянное: 1:1. Вес взрослой собаки 25 — 30 кг.

    Характер и привычки

    Описание характера кеесхондской породы можно свести лишь к перечислению многочисленных достоинств собаки.

    1. Отличный охранник, который с честью защитит свою семью и территорию.
    2. Надежный человек-компаньон.
    3. Готов долго проводить время с детьми, любит их всем сердцем.
    4. Здоровье у Кеесхондов отличное, любит проводить время в активном режиме — играть и развлекаться, способен подолгу находиться в доме, гулять не надо часто и скучно.

    Сказанное выше относится к взрослым особям, щенки кеесхонда доставят хлопот собственной активностью и любознательностью. С Кититами не будет времени на срочные занятия, щенки потребуют внимания и общения.Любовь и преданность собак семье безгранична.

    Немного подозрительно, хотя собака дружелюбная и любвеобильная. Не требует повышения голоса и поднятия хлыста, хозяина понимает с полукукареканьем. Собака способна чувствовать переживания и заботу хозяина, в трудные минуты сыграет роль психолога.

    Кеесхонды не ревнивы, спокойно позволяют хозяину общаться с другими городскими или чужими питомцами. Отлично ладит с кошками и спокойно передвигается на общей территории.В собаках генетически заложена легкость адаптации в разных местах, однако собакам рекомендуется социализироваться с малого возраста.

    Негативные проявления не свойственны собакам:

    • Агрессия;
    • Зависть;
    • Злоба;
    • Капризность;
    • Раздражает.

    Привыкая к жизни по соседству с человеком, собака породы кеесхонд веками не меняла своего характера. Еще добрый и внимательный к людям в быту, преданный и исполнительный в работе.Животное служит в индивидуальных психотерапевтических консультациях США, в хосписе. Считается, что милое создание способно спасти человека от любой депрессии. Горшки помогают людям общаться с другими.

    Отличаясь особой чувствительностью, Кеесхонд умеет определять настроение хозяина. Маленькие дети подходят. Когда друг плачет, пес подойдет и пойдет рядом. Уставший питомец не станет беспокоить, мирно отойдет в сторонку. Это лучший друг для пожилых одиноких людей, которым часто не хватает общения.

    Увидев воду, Кеесхонд пытается плыть. Видимо, природная слабость баржевой собаки осталась в крови, постоянно живя у воды или оставаясь с хозяином в плавании.

    Уход за кеесхондом

    1. В квартирных условиях уборка шерсти должна производиться ежедневно, улица наполнена загрязнениями и другими негативными факторами.
    2. Над городом допустимо проведение процедуры, там меньше загрязнена атмосфера.
    • В качестве инструмента выберите специальную щетку, которой можно обрабатывать пышную шерсть.
    • Не производите расчесывание на короткое время, дайте собаке насладиться процедурой. Пинсик получает долгожданный массаж кожи, улучшающий регенерацию и кровообращение.
    • Правильный уход за кассогдомом требует купания, но часто стирать ПСА не нужно: возникает раздражение, шерсть теряет защитный слой.
    • Не разрешается стричь собаку, вам придется привыкнуть к ее естественному виду.
    • Внимательно следите за кормом для домашних животных.


    Ссылку можно два раза в год. В это время густой подшерсток доставляет немало хлопот, если питомец живет в доме. Полный грунт рекомендуется ежедневно. Это убережет жилище от выпадения шерсти, сократит время линьки. Длинную шерсть полагается тщательно убирать, не допуская сваливания. В период между ссылками о расческе вспоминают два раза в месяц. Шерсть чаще вычесывать не стоит, аналогичное действие приведет к вычесыванию подшерстка.

    Собака, выросшая у моря и обожающая плавать, не любит мыться дома. К процедуре прибегают справа. Собака чистенькая, отдельные особи даже успевают помыть лапу, как кошки.

    Болезни и профилактика

    Здоровье породы Кеесхонд досталось по наследству от предков, мало знающих о болезнях. Единственным слабым местом является склонность к ожирению. Чаще всего от полноты страдает партия, если хозяин неправильно составляет рацион или нарушает нормы кормления питомцев.

    Для предотвращения лишнего веса достаточно ограничивать собаку в еде и давать нагрузку во время прогулок.

    Режим и диета

    В связи со склонностью к полноте и ожирению кормить собак рекомендуется аккуратно и сбалансировано. Лучшим решением для кормления кеесхонда будут сухие сбалансированные корма. Не следует сомневаться в том, что малейшие отклонения в питании или нарушение режима способствуют мгновенному выходу из строя организма. Сухой корм выбран из категории Премиум и подходит для данного типа собак.

    1. Кормление с кормом рекомендуется проводить два раза в день, соблюдая рекомендации на упаковке.
    2. Для суспензии указанные порции лучше несколько уменьшить, тогда у собаки точно не будет ожирения.

    Детям кеесхонды нужно срочно кормить. К сухому корму лучше приучать с детства, не пытайтесь вводить натуральную пищу, несбалансированность меню не отразится на здоровье питомцев. После еды миску рекомендуется почистить собаку, чтобы собака не совала нос в поисках лишней еды.

    От питания зависит дальнейшая судьба собаки, ее здоровье, продолжительность жизни. Домашняя любимица способна дожить до 17 лет, проявляя активность до 13-14 лет. Чтобы лишний вес не омрачил жизнь щенков, необходимо строго дозировать количество еды и не баловать животное перекусами. Кормить собаку рекомендуется в установленное время. Допустимо разделить дневную норму на два приема пищи. В миске собак постоянно присутствует чистая вода.

    Обучение и обучение

    Обучение Кеесхонда требует четко сформулированного подхода, иначе толку от занятий не будет.Собаки легко обучаются, стремятся угодить хозяину и продемонстрировать выработанные навыки. Они любопытны и любознательны, схватывают уроки на лету. Основные команды питомец выучит без труда, за что хозяин призван вознаграждать лакомствами и добрыми словами. Во время дрессировки предполагается проявлять любовь, не подпускать собаку к собаке.

    Ярким стимулом для собаки станет улыбка хозяина и дружелюбный игривый настрой. Обладая хорошим терпением, хозяин способен воспитать из Кешонды трудолюбивого помощника, который с легкостью будет выполнять разные команды, в том числе и невероятные трюки.Несистематические занятия не дадут должного результата.

    Помните, собака чувствует изменение настроения и интонации. Проявление злобности воспринимается собакой негативно, у нее будет подорвано стремление к дрессировке. Разбавление занятий играми хорошо повлияет на психологическое и физическое состояние собаки.

    Кеесхонд или вольфшпиц (также Wolf Schitz, англ. Keeshond) Порода собак среднего размера, с двойной густой серо-черной шерстью. Он принадлежит немецкому шпицам, но настоящую популярность приобрел в Нидерландах.

    • Они всегда предупредят семью о приближении к чужому, но Лай может стать проблемой, если собака промахнется.
    • Любят семью, детей и вообще проявляют агрессию к человеку.
    • Умный, простой в изучении и понимающий, что это невозможно.
    • У них постоянная улыбка на лице, что отражает свойства их характера.
    • Лучший способ испортить собаке психику — держать ее отдельно от семьи.Они любят везде сопровождать семью и совершенно не подходят для жизни в вольере или на цепи.
    • Уход относительно прост, но два раза в год они меняют белье. Но запаха собаки нет.

    История породы

    Кеесхонды произошли от древних собак, потомками которых были такие популярные породы, как хаски, померанский шпиц и другие. Современные собаки появились в Германии, где первые упоминания о них встречаются в 1700 году.

    Кроме того, есть картинки с изображением волкодавов того времени.Хотя он и относится к немецким шпицам, именно Нидерланды, а не Германия станут местом, где он развился и стал популярен.

    В 1780 году Нидерланды были политически разделены, с одной стороны, правящей верхушкой династии Оранжистов, а с другой — патриотами. Предводителем патриота был Корнелиус де Гизелир (англ. Cornelius de Gyzelaar) или «Кеес».

    Он обожал собак этой породы, которые везде сопровождали хозяина. Именно в его честь и будет называться порода Кеесхонд, от «КЕЕС» и «ХОНД» — собака.

    Корнелиус де Гизелар считал, что сила и преданность этой породы подходят его патриотам и сделал собаку партийным символом. Его партия подняла бунт против династии Оранжистов, но он потерпел поражение.

    Естественно, победители старались уничтожить всех противников, их партию и символику. Большинство владельцев собак и владельцев питомников были вынуждены избавиться от своих собак, чтобы те, кто продолжает, не ассоциировались с неудачным восстанием. Только самые верные хозяева будут продолжать содержать этих собак.

    Большинство из них были крестьянами и порода возрождается на фермах и в деревнях, вдали от власти. Часть собак живет на лодках и баржах, перевозящих уголь и деревья, между Нидерландами и Рейнской провинцией в Германии. Часть населения приходится на другие страны: Италию, Францию, Германию.

    Но, порода настолько ассоциируется с Нидерландами, что в те времена их даже называли голландским волчьим шпицем. Несмотря на это, собаки относятся к немецким шпицам.

    К концу девятнадцатого века собаки этого типа попадают в Англию, где их называют Фокс Дог, Голландская баржевая собака.Первый стандарт породы Вольшпиц был опубликован на выставке собак в Берлине (1880 г.), а вскоре после этого, в 1899 г., был организован Клуб немецких шпицев.

    Nederlandse Keeshond Club был создан в 1924 году. Стандарт породы был пересмотрен в 1901 году, чтобы добавить окрас, который мы знаем сегодня — серебристо-серый с черными кончиками. Но, о дальнейшей популярности, сказала Первая мировая война.

    В 1920 году породой заинтересовалась баронесса фон Харденбрук. Она начала собирать информацию о сохранившихся после войны собаках.Удивительный интерес к породе сохранился у капитанов речных судов и фермеров.

    Большинство Вольфсфецев сохранили свой первоначальный вид, некоторые владельцы даже вели свои неформальные племенные книги.

    Забытая и низконогая порода в свое время, но баронесса начала свою программу разведения. Она вызовет интерес у публики и через 10 лет Цешонду возродят из пепла.

    В 1923 г. они начинают появляться на выставках собак, в 1925 г. организуется клуб любителей породы — Клуб голландских барж-догов.В 1926 году Британский клуб собаководства регистрирует породу и в том же году у них появляется официальное название Кеесхонд, которое вытеснит старое. В то же время собаки попадают в Америку и уже в 1930-е годы породу признает АКС.

    В 2010 году она заняла 87 место среди 167 признанных АКС пород по количеству зарегистрированных собак. Изначально созданные как собаки-компаньоны, они прошли долгую и непростую историю.

    Не будучи ни охотой, ни службой, они стали для человека верными и любящими друзьями.Это сказалось на их дружелюбии, привязанности к хозяину и преданности.

    Описание породы

    Кеесхонд относится к шпицам и унаследовал все характерные для них признаки: маленькие стоячие уши, роскошную и густую шерсть, пушистый хвост с поеданием. Это компактная собака среднего размера.

    Американский клуб собаководства (AKC) Стандарт породы 43–46 см в холке, Международная кинологическая федерация (FCI) 19,25 дюйма (48,9 см) ± 2,4 дюйма (6,1 см). Вес от 14 до 18 кг.Кобели тяжелее и крупнее сук.

    При взгляде сверху голова и туловище образуют клин, но пропорциональные друг другу. Миндалевидные глаза, широко расставленные, темного цвета. Морда средней длины, с ярко выраженным стопом.

    Плотные темные губы скрывают белые зубы, ножницеобразный прикус. Уши должны быть стоячими и высоко на голове, треугольной формы, маленькие, темного цвета.

    Шерсть типичная для всех косообразных; Толстый, двойной, роскошный. Верх рубахи из прямой и жесткой шерсти, низ из толстой бархатной подстилки.Голова, морда, уши покрыты мягкой, короткой, прямой шерстью, бархатистой на ощупь. На шее и груди шерсть длиннее и образует роскошную гриву. На задних лапах штаны, а на хвостах хвосты.

    Цвета волка уникальны и неповторимы. Различая от светлого до темного, он состоит из смеси серого, черного и кремового цвета. Густой подшерсток серого или кремового (но не бурого) цвета и длинная покровная шерсть с черными кончиками. Лапы кремовые, а грива, плечи и штаны светлее остальных. Морда и уши должны быть темными, почти черными, обязательно должны быть очки.

    Исторически кеесхонд, как представитель пряноподобного типа собак, порвал с другими спицами и был нескольких окрасов — белый, черный, рыжий, кремовый и серебристо-черный. Сначала допускались разные окрасы, но в итоге остался только волк. Хотя толфспины других окрасов выглядят потрясающе, допустить их к участию в шоу нельзя.

    Внешний вид впечатляет; Даже на прогулке собака выглядит готовой выйти на подиум. Сама по себе густая шерсть уже привлекает, а ее необычный и заметный окрас делает собаку неотразимой.Темные круги вокруг глаз и собака, казалось, носила очки.

    Несмотря на такое гламурное описание, это серьезная собака, а роскошная грива собак делает породу одной из самых красивых в собачьем мире. Она похожа на собаку шоу-класса, но есть в ней что-то от лисы: вытянутая морда, стоячие уши, хвост и хитрая улыбка на мордочке.

    Характер

    Кеесхонд — одна из немногих пород, выведенных не для охоты или службы, они были исключительно с собаками-компаньонами.

    Они любвеобильны и искренне ценят общение с мужчиной. Это добродушный и веселый компаньон, особенно любящий детей и любое времяпрепровождение в кругу семьи.

    Для него быть рядом с любимыми людьми в жизни. Их называют тенью своего хозяина, но при этом они одинаково привязаны ко всем членам семьи и любят всех сразу, не отдавая предпочтения кому-то.

    По сравнению с другими немецкими спицами, кеесхонда более спокойная, не такая доминантная и очень привязанная.Даже если в помещении есть другие люди, но из него вышел хозяин, собака будет сидеть и ждать, пока он вернется. У них сильно развита интуиция и они чувствуют настроение человека, они отличные поводыри для слепых и хорошо говорят на Ловкости и обиженных.

    На протяжении всей своей истории они были популярны как сторожевые собаки, так как у них громкий и юморной ламин. Эти остались и сегодня, кеесхонд всегда предупредит хозяина о гостях или странной активности. Волчьи косы устрашающие и крикливые, но неагрессивные по отношению к человеку, чаще всего наоборот.

    Все, что они делают это идет, но нужно учитывать, что такой лай может раздражать ваших соседей. Особенно, если собака долгое время остается без общения с хозяином и начинает лаять от стресса. Правда, при правильной тренировке его можно снять с неуправляемых фласов.

    В своей книге «Интеллект собак» Стэнли Корен называет их великолепной породой, имея в виду способность обучать новым командам и ставит на 16 место по уровню интеллекта.

    Для этого им необходимо от 5 до 15 повторений, а подчинены они в 85% случаев и более.Большинство считает, что кеесхонды умны и любвеобильны, и это автоматически делает их идеальной семейной собакой, к тому же легко обучаемой.

    Да, они отлично подходят для семей, но только для тех, кто имеет опыт содержания других пород и ладит друг с другом. Как и другие породы с независимым мышлением, кеесхонда крайне плохо реагирует на грубые приемы костюмера.

    Это чувствительная порода собак, которая более остро реагирует на громкие звуки и не плохо уживается в семьях, где часто кричат ​​и выясняют отношения.

    Кеесхонды быстро учатся, если их владельцы последовательны, вежливы и спокойны. Для них хозяин должен быть вождем стада, который управляет и направляет их жизнь.

    Собаки инстинктивно понимают силу хозяина и эта порода не исключение.

    Быстро учатся, при этом как хорошо, так и плохо. Попытка изменить нежелательное поведение с помощью грубых методов приведет к негативным изменениям в характере собаки, сделает ее нервной, испуганной, испуганной.Дрессировать этих собак нужно мягко и терпеливо, без напряжения и криков.

    Если у собаки проблемы с поведением, то будьте готовы к бесконечной даме, засаленной обуви, испорченной мебели. Большинство этих проблем происходит от обиды, скуки или отсутствия общения с хозяином.

    Если щенок не вырос в управляемую собаку, то эти маленькие умные зверьки могут себя развлекать, и зачастую такие развлечения губительны.

    Воспитывать щенка нужно не в страхе, а в уважении к человеку.Им хочется радовать и радовать свою семью, поэтому, когда собака не слушается, нужно просто проявить терпение, а не грубость.

    И да, тем, кто хочет содержать собаку в вольере или во дворе, эта порода не подойдет. Им нужен постоянный контакт с людьми и активность, чтобы оставаться счастливыми.

    Как и в любой породе, чем раньше щенок будет социализирован, тем лучше. Добавляйте в него новых людей, ситуации, животных. Это поможет вырастить из щенка спокойную и уравновешенную собаку.

    Они так прекрасно ладят с детьми, хорошо ладят с другими животными, поэтому социализация нужна не для того, чтобы снизить агрессию, а для того, чтобы избежать серьезности и пугливости.

    В отличие от многих других пород, склонных к агрессии, кеесхонды чрезмерно любвеобильны и должны понимать, когда этого достаточно, даже если речь идет о любви.

    Это игривая собака, для которой необходимы ежедневные игры и длительные прогулки, желательно со всей семьей. Порода рекомендуется для активных семей, которые будут везде брать собаку с собой.Неважно, будет ли это пешая прогулка, езда на велосипеде, рыбалка – Кеесхонда везде интересуется, есть ли поблизости семья.

    Идеально подходят для подстраивания и обиды, к тому же такая активность рекомендуется, так как собака нагружается физически и интеллектуально.

    Активность, нагрузка и усталость помогают собаке избавиться от проблем с поведением.

    Волчьи шипы способны заботиться где угодно, от квартиры до частного дома, просто до семьи. Правда, они лучше себя чувствуют в прохладном климате, не любят высокую температуру и влажность.

    Уход

    Как и у большинства косовидных пород, имеет роскошную шерсть, но уход за ней не так утомителен, как можно было бы ожидать. Ежедневное расчесывание делает собаку красивой и ухоженной, а дом чистым от собачьей шерсти.

    Собаки умеренно худеют в течение всего года, но подшерсток хорошо ложится два раза в год, весной и осенью. В это время желательно чаще вычесывать собаку, чтобы избежать колтунов.

    Густая шерсть защищает от украшений и солнца, поэтому не рекомендуется к триммингу.Кеесхонда не склонна к запаху таблеток и часто купаться за ними не нужно и не рекомендуется, обычно умываются только по мере необходимости.

    Здоровье

    Это здоровая порода, средняя продолжительность жизни 12-14 лет. Они склонны к ожирению, поэтому правильное, умеренное кормление и регулярные нагрузки важны для здоровья собаки.

    Посмотрите:


    Запись навигации .

Добавить комментарий

Ваш адрес email не будет опубликован.