Содержание

лучшее средство от паразитов для кошек

лучшее средство от паразитов для кошек

лучшее средство от паразитов для кошек

>>>ПЕРЕЙТИ НА ОФИЦИАЛЬНЫЙ САЙТ >>>

Что такое лучшее средство от паразитов для кошек?

Почти год боролись с кашлем у нашей внучки. Что только не попробовали, кашель не исчезал. Наша участковая посоветовала искать глистов. Сколько мы не проверяли, анализы не показывали их наличие. Скорее всего это говорит не об отсутствии глистов, а о качестве проведения анализов. Решили мы начать борьбу с глистами, выбрали лекарство от паразитов Бактефорт. И нисколько не пожалели! Через полтора месяца мы забыли о кашле. Жаль только, что лечение требует длительного времени, а результатом мы довольны.

Эффект от применения лучшее средство от паразитов для кошек

Ежедневная дозировка препарата для всех одна и составляет 20 капель. Однако длительность лечения напрямую зависит от возраста заболевшего. Паразитологи не советуют использовать «Бактефорт» больше месяца. Более длительный прием может привести к возникновению аллергии. Добавка не считается токсичной, но ее прием не рекомендуется тем, у кого выявлены хронические проблемы в работе желудочно-кишечного тракта или желчного пузыря. Детский возраст, индивидуальная непереносимость и период кормления грудью также являются однозначным противопоказанием к приему капель от паразитов «Бактефорт».

Мнение специалиста

Бактефорт (Bactefort) – концентрированный раствор растительного происхождения, предназначенного для борьбы с кишечными паразитами, для внутреннего применения. Имеет множество полезных свойств, может применяться без контроля врача. Даже если вы придерживаетесь гигиены, у вас нет домашних животных, могут появиться паразиты в организме. Которые могут осесть и в печени, глазах, мозге, что принесет еще больший вред организму. И не каждый человек сразу же пойдет к врачу или расскажет кому-либо, ведь многие считают это чем-то постыдным. Существует сейчас очень много средств для борьбы с гельминтами, в их список попадают капли от паразитов bactefort.

Как заказать

Для того чтобы оформить заказ лучшее средство от паразитов для кошек необходимо оставить свои контактные данные на сайте. В течение 15 минут оператор свяжется с вами. Уточнит у вас все детали и мы отправим ваш заказ. Через 3-10 дней вы получите посылку и оплатите её при получении.

Отзывы покупателей:

Марина

Летом ездили в отпуск, а кошку (не с кем было оставить) отвезли в деревню к бабушке, а когда забрали оказалось, что у нее глисты. Сдали детям анализы – и они уже успели от кошки подхватить эту гадость. Мы с семьей бактефорт пропивали, состав натуральный, поэтому детям смело. Анализы после курса чистые были)

Варя

Bactefort – уникальный современный препарат, созданный для устранения паразитарной инвазии различной природы. Он помогает даже тогда, когда самые мощные средства не дают должного результата. Но из-за возможности приобрести его только у официальных производителей, многие больные боятся и не всегда делают правильный выбор. Bactefort прошел все необходимые проверки и официально одобрен организациями здравоохранения, что делает его полностью безопасным для употребления и лечения.

Препарат работает в такой последовательности: Желчегонный, мочегонный эффект; Слабительный эффект; Очищение. Все эти действия нужны для того, чтобы паразит быстрее вышел из организма. Но не стоит применять препарат, если собрались в длительный путь. Ведь мочегонный и слабительный эффекты не заставят себя долго ждать. Где купить лучшее средство от паразитов для кошек? Бактефорт (Bactefort) – концентрированный раствор растительного происхождения, предназначенного для борьбы с кишечными паразитами, для внутреннего применения. Имеет множество полезных свойств, может применяться без контроля врача. Даже если вы придерживаетесь гигиены, у вас нет домашних животных, могут появиться паразиты в организме. Которые могут осесть и в печени, глазах, мозге, что принесет еще больший вред организму. И не каждый человек сразу же пойдет к врачу или расскажет кому-либо, ведь многие считают это чем-то постыдным. Существует сейчас очень много средств для борьбы с гельминтами, в их список попадают капли от паразитов bactefort.

Содержание страницы. Лучшие лекарства от кишечных паразитов широкого спектра действия. Фенасал. Пиперазин. Мильбемакс. Дирофен. Лучшие лекарства от простейших паразитов для кошек. Бисептол. Триметоприм. Метронидазол. Тинидазол. Фуразолидон. Препараты Обзор средств от гельминтов для кошек. Глистная инвазия или заражение гельминтами это опасное поражение кошачьего организма, которое может погубить животное или вызвать серьезные заболевания. Рейтинг лучших и эффективных средств для кошек и котят. В каких случаях необходимо обратиться к врачу и как не допустить . Производитель дает гарантию, что все названные виды паразитов не появятся повторно на протяжении 1,5-2 месяцев после обработки. Цена флакона объемом 20 мл составляет около. От последнего вида паразитов обычно никакое глистогонное для кошек эффективным не бывает. . Едва ли не самое лучшее от глистов средство. . Глистогонных средств, подходящих для лечения кошек существует множество. Можно выбрать лекарство, помогающее от всех видов гельминтов. Применять для кошек глистогонные препараты нужно не только при обнаружении паразитов, но и для . Мильбемакс. Комбинированное средство на основе празиквантела и мильбемицина оксима считается одним из лучших глистогонных препаратов для кошек. Выпускается в 2-х вариантах – для. Глистогонное средство для кошек Мильбемакс имеет в своём составе два . Как и другие оральные средства от глистов, суспензию лучше давать утром до . Фотогалерея: суспензии от глистов для кошек. Суспензия для кошек Празицид относится к неопасным видам лекарств, но перед тем, как давать её. Пока паразитов немного, животное может не замечать их присутствия в своем . Ведь лучшее средство от глистов для котят и котов – это их предупреждение. . Давать их нужно за две недели до процедуры. Средство от глистов для кошек взрослых с целью профилактики применяют не реже двух раз в год. Между тем размножение паразитов происходит стремительно, оказывая . Помимо этого, глистогонные лекарственные средства для кошек могут иметь в своем . Если говорить про таблетки от глистов для кошек, то хорошо зарекомендовали себя Дронтал, Мильбемакс, Каниквантел, Каниквантел плюс, Дирофен, Прател. Противоглистные препараты для кошек разрушают оболочку гельминтов, оказывают губительное влияние на их нервную систему, вызывают у них паралич мышечных волокон, лишая паразитов подвижности. Самые эффективные таблетки от глистов. Как их давать? Если в доме живет усатый мяукающий друг, то ему. Официальный интернет-магазин товаров для животных Beaphar. · Продавец: Beaphar. Адрес: Россия, Мытищи, 1-й …
http://dream-mebel.com/pic/klinistil_sredstvo_ot_parazitov7228.xml
http://www.thepdana-y.com/uploads/boremsia_s_parazitami_narodnymi_sredstvami6817.xml

http://minhnguyenvn.com/uploads/userfiles/aptechnye_sredstva_ot_parazitov9450.xml
http://www.erloeserkirche-rodenkirchen.de/userfiles/narodnye_sredstva_ot_gelmintov_i_parazitov6734.xml
Ежедневная дозировка препарата для всех одна и составляет 20 капель. Однако длительность лечения напрямую зависит от возраста заболевшего. Паразитологи не советуют использовать «Бактефорт» больше месяца. Более длительный прием может привести к возникновению аллергии. Добавка не считается токсичной, но ее прием не рекомендуется тем, у кого выявлены хронические проблемы в работе желудочно-кишечного тракта или желчного пузыря. Детский возраст, индивидуальная непереносимость и период кормления грудью также являются однозначным противопоказанием к приему капель от паразитов «Бактефорт».
лучшее средство от паразитов для кошек
Почти год боролись с кашлем у нашей внучки. Что только не попробовали, кашель не исчезал. Наша участковая посоветовала искать глистов. Сколько мы не проверяли, анализы не показывали их наличие. Скорее всего это говорит не об отсутствии глистов, а о качестве проведения анализов. Решили мы начать борьбу с глистами, выбрали лекарство от паразитов Бактефорт. И нисколько не пожалели! Через полтора месяца мы забыли о кашле. Жаль только, что лечение требует длительного времени, а результатом мы довольны.
Лучшие таблетки от паразитов для человека. Если возникает вопрос, как вывести паразитов из организма человека таблетками, следует учитывать важный нюанс. Речь идет о том, что каждый из препаратов направлен на выведение лишь определенных гельминтов. Если применять неподходящие средства. Препарат против глистов. Способствует избавлению мышечной системы паразитов при помощи уничтожения нервно- мышечного . Лекарство состоит из растительных и животных компонентов, которые помогут избавится от паразитов. Природные компоненты, входящие в состав интохиса: Джунгарская. Рейтинг лучших средств от глистов по мнению врачей и отзывам покупателей. . Именно поэтому не существует универсального средства от паразитов. То, что действует на круглых и плоских червей совершенно не влияет на простейших, и наоборот. Нужно точно знать, чем именно человек поражён, поскольку. Лекарство от паразитов в организме человека. На сегодняшний день фармацевты разработали медикаментозные лекарства . Какие таблетки от паразитов самые эффективные? Чтобы избавиться от недуга среди таблеток от трематод выделяют: Альбендазол; Хлорохин. Знать, какие есть эффективные средства от паразитов, должен каждый, ведь их носителями является 95% населения Земли. Существует более 2 000 видов вредителей, которые могут жить в организме человека. Место. Наименование. Характеристика в рейтинге. Лучшие средства от паразитов широкого спектра действия. 1. Вормин. Лучшее универсальное средство для борьбы с паразитами разных типов. 2. Вермокс. Средство широкого спектра действия. Малый риск возникно. Эффективные препараты от паразитов: суть проблемы, требования к лекарствам от глистов. . В теле человека паразиты живут испокон веков, здесь они находят идеальные условия для своего существования, забирая у организма часть питательных веществ и отравляя его отходами своей жизнедеятельности. Лекарства от паразитов — Пирантел – относительно малотоксичные таблетки от глистов, поэтому могут применяться для . Intoxic поможет избавиться от паразитов всего за один месяц. Часто заражение глистами проходит совершенно бессимптомно, поэтому не каждый человек знает, что у него в. Стоит ли принимать препараты от паразитов для профилактики? Какие таблетки от глистов подходят детям и беременным? . Определить, какое лекарство нужно принимать в том или ином случае, может только врач-инфекционист, паразитолог. В российских регионах зафиксировано более 70 видов гельминтов. Не все люди знают, что для борьбы с паразитирующими микроорганизмами создано множество препаратов и способов лечения. Но даже лучшие лекарства от паразитов нельзя подобрать без осуществления диагностики и консультации врача. Любой препарат содержит с.

Брометронид новый 100 гр — Бровафарма

Брометронид новый порошок

порошок для перорального применения

Состав

1 г препарата содержит:

тинидазол — 250 мг

Описание

Порошок светло-желтого цвета, микрогранулированный, плохо растворяется в воде.

Фармакологические свойства

Тинидазол — синтетический препарат широкого спектра действия на простейших Balantidium coliEntamoeba hyslolyticaTreponema hyodysenterieHistomonas meleagridisLamblia intestinalisEimeria spp., Trichomonas columbaeT. gallinae, бактерицидного действия на анаэробов Bacteroides spp.Fusobacterium spp.Clostridium spp., большинство видов грамположительных и грамотрицательных кокков и пр.

Быстро и почти полностью абсорбируется из ЖКТ. Максимальная концентрация в сыворотке крови достигается через 2 часа и сохраняется в течение 12 часов. Хорошо распределяется во всех тканях организма, биотрансформируется в печени. Около 60% препарата выводится с мочой, 12% — с калом.

Показания

Лечение животных при заболеваниях, которые вызваны микроорганизмами, чувствительными к тинидазолу:

• птица (голуби, декоративные фазаны) — гистомоноз, трихомоноз, эймериоз, сальмонеллез;

• собаки, коты — лямблиоз, амебиоз, трихомоноз, другие анаэробные инфекции;

• декоративные кролики — эймериоз.

Противопоказания

Не назначать курам-несушкам.

Способ применения и дозы

Препарат применяют перорально, предварительно смешивая с кормом.

Дозы препарат для различных видов животных приведены в таблице.

 

Вид животных

Доза, г

Применение

на 1 кг корма

на 10 кг массы тела

Птица (голуби, декоративные фазаны):

лечение 

2

 

10 дней

Собаки:

лямблиоз

 

0,8-1

5 дней

анаэробные инфекции

 

0,4-0,5

2-3 недели

амебиоз 

 

0,5-0,6

5 дней

Коты:

лямблиоз, трихомоноз 

 

0,4-0,5

10 дней

Декоративные кролики:

эймериоз (взрослые животные)

 

2-3

3 дня

профилактика во время отлучения от матери

 

1

10 дней

Предостережения

У животных, чувствительных к тинидазолу, могут возникать аллергические реакции в виде лихорадки, крапивницы, рвоты. После прекращения применения препарата эти симптомы исчезают без специального лечения.

После последнего применения препарата забой животных на мясо разрешается через 7 суток.

Упаковка

Полимерные пакеты по 10, 100, 400 г.

Условия хранения

В сухом, темном месте при температуре от 0 до +20 °С.

Срок годности

3 года.

гиардия!!! — Мир животных

)Panacur- lt. Beipackzettel эффективен против лямблий у собак. Для кошек тоже(не оффициально), но вместо указанных 3-ёх дней, даётся 5 дней-3пауза-5дней. для беременных-НЕТ, даже доза рассчитанная на дня запрещена беременным кошкам.

Описание Panacur (Панакур) суспензия 100 мл.:

Глистогонное средство широкого спектра действия для лечения домашних собак и кошек. Входящий в состав препарата фенбендазол обладает широким спектром антигельминтного действия, активен в отношении взрослых форм, личинок и яиц нематод желудочно-кишечного тракта и легких, паразитирующих у животных. Панакур по степени токсического воздействия на теплокровных животных относится к малоопасным веществам в терапевтических дозах не обладает кумулятивным, эмбриотоксическим, тератогенным и аллергенными свойствами.

У взрослых собак и кошек:
Для лечения взрослых собак и кошек, инфицированных желудочно-кишечными нематодами и цестодами.
Ascarid spp. (Toxocara canis, Toxocara cati and Toxascaris leonina)
Ancylostoma spp.
Trichuris spp.
Uncinaria spp.
Taenia spp.

Щенки и котята
Для лечения щенков и котят, зараженных желудочно-кишечными нематодами и простейшими (Giardia SPP.).

Беременные собаки
Для лечения беременных собак, чтобы уменьшить предродовые инфекции Toxocara canis и передачи Т. Canis и Ancylostoma caninum щенкам через молоко.

Другое
Для лечения собак, зараженных lungworm Oslerus (Filaroides) osleri, или простейшими Giardia SPP. и кошек зараженных lungworm Aelurostrongylus abstrusus.

Панакур вызывает гибель взрослых форм, личинок и яиц нематод желудочно-кишечного тракта и легких, а также цестод.

дозировка

Регулярная обработка взрослых собак и кошек
4 мл на 1 кг массы тела однократно (= 100 мг фенбендазол / кг массы тела).

Доза должна быть смешана с кормом или дана перорально непосредственно после кормления.
Регулярную обработку рекомендуется проводить от 2 до 4 раз в год. Более частая обработка с интервалом от 6 до 8 недель рекомендуется для собак в питомниках.

Щенки и котята в возрасте до шести месяцев
2 мл на кг массы тела в сутки в течение 3 дней подряд после кормления или смешивать с пищей (= 50 мг фенбендазола на кг. массы тела ежедневно в течение 3 дней).
Практические лекарственные рекомендации:
вес / доза
250 г. — 0,5 мл в день в течение 3 дней
500 г. — 1 мл ежедневно в течение 3 дней
1 кг. — 2 мл ежедневно в течение 3 дней
1,5 кг. — 3 мл ежедневно в течение 3 дней
2 кг. — 4 мл ежедневно в течение 3 дней

Для щенков с массой тела более 2 кг, дополнительно 2 мл на каждый кг. массы тела. Щенки должны быть обработаны в 2 недельном возрасте, 5-недельном возрасте и прежде чем покинуть питомник. Обработка может также потребоваться в 8 и 12 недель. После этого, частота обработки может быть уменьшена, если щенки остаются в питомниках.

Беременные собаки
1 мл на 1 кг массы тела в день с 40 дня беременности и постоянно до 2 дней после родов (примерно 25 дней) (= 25 мг фенбендазола / кг массы тела в сутки).
Практические лекарственные рекомендации:
От 2 до 4 кг — 4 мл ежедневно в течение прибл. 25 дней
От 4 до 8 кг — 8 мл ежедневно в течение прибл. 25 дней
От 8 до 16 кг — 16 мл ежедневно в течение прибл. 25 дней

Беременные кошки
Беременные кошки могут быть обработаны Panacur, однократно обычной дозой для взрослых.
4 мл на 1 кг массы тела в виде разовой дозы (= 100 мг Fenbendazole / кг веса тела).

Увеличение дозировки возможно для лечения заражения червями у взрослых собак и кошек или Giardia SPP.
2 мл на кг массы тела в сутки в течение 3 дней подряд (= 50 мг фенбендазол / кг массы тела в сутки в течение 3 дней).

Для контроля lungworm Oslerus (Filaroides) osleri у собак применять 2 мл на кг веса тела, ежедневно в течение 7 дней подряд (= 50 мг Fenbendazole / кг массы тела в день в течение 7 дней).

Повторный курс лечения может потребоваться в некоторых случаях.
Для контроля lungworm Aelurostrongylus abstrusus у кошек — 2 мл на кг веса тела в день в течение 3 дней подряд (= 50 мг фенбендазол / кг массы тела в день в течение 3 дней).

Противопоказания, предупреждения, и т.д.
Прямой контакт с кожей должны быть сведены к минимуму. Мойте руки после использования.
Производите оценку массы тела настолько точно, насколько это возможно, до расчета дозировки.
Только для лечения животных. Хранить в недоступном для детей месте.

Щадящая дозировка применяется для профилактики и у ослабленных животных:
П
рименение суспензии у взрослых кошек в т.ч. беременных:
1 мл на 1 кг массы тела однократно (1 мл суспензии содержит 100 мг фенбендазола)
Доза может быть смешана с кормом, или перорально непосредственно после кормления;

Применение суспензии у сильно зараженных взрослых кошек, а также при заражении простейшими:
1 мл на 2 кг массы тела в течении 3х дней

Применение суспензии у котят в возрасте до шести месяцев:
0,5 мл на 1 кг массы тела ежедневно в течение 3 дней подряд перорально после кормления.
Такая схема применения исключает передозировку и интоксикацию от гибели паразитов.

срок использования: январь 2017 г.

На злость-шикарно улыбаюсь, на грубость-не считаю нужным отвечать, на дураков-не обижаюсь, а на завистников- плевать!

ФГБУ Северо-Кавказская МВЛ — Антибиотики в мясной продукции -нежелательный иммунитет

Специалисты ФГБУ «Ставропольская межобластная лаборатория» обнаружили в  пробах печени цыплят  бройлеров антибиотик – тинидазол.

 Препарат ряда нитроимидазолов был выявлен в результате исследования, которое проводилось методом высокоэффективной жидкостной хроматографии с масс-спектрометрическим детектором.

Тинидазол – антибактериальный препарат, который предназначен для лечения животных и птицы при заболеваниях, вызванных микроорганизмами, чувствительными к тинидазолу (балантидиоз у свиней, трихомоноз у коров и быков-производителей, лямблиоз у мелких домашних животных – собак и кошек, а также сальмонеллезе и гистомоноз кур, индеек, уток и гусей).

 Тинидазол также широко используется и для лечения заболеваний у взрослых и детей. Соответственно, если человек постоянно употребляет в пищу мясную продукцию с содержанием этого препарата, то у него вырабатывается привыкание к данному виду антибиотика. В случае лечения требуются более сильные лекарственные средства с большими дозами.

 Ещё один побочный эффект от применения продуктов, содержащих остатки лекарственных препаратов – аллергические реакции. Антибиотики в мясе могут также стать причиной снижения иммунитета, особенно у детей.

Тинидазол — не единственный препарат, на который стоит обратить внимание. В связи с тем, что группы применяемых антибиотиков у людей и животных в сельском хозяйстве одинаковы, все они могут вызвать нежелательный иммунитет к действию антибиотиков.

 Чтобы ветеринарные препараты не причиняли в последующем вреда человеку, специалисты ФГБУ «Ставропольская межобластная ветеринарная лаборатория» напоминают: использование антибактериальных препаратов в фермерских хозяйствах должно проводиться строго в соответствии с установленными нормами.

 После введения антибиотика должен пройти определённый срок (для каждого препарата он прописывается отдельно), в течение которого лекарство выводится из организма животного. Только после этого можно допускать к реализации и употреблять продукцию животного происхождения.

Антибиотики в мясной продукции -нежелательный иммунитет

19 июня 2020 09:51

Препарат ряда нитроимидазолов был выявлен в результате исследования, которое проводилось методом высокоэффективной жидкостной хроматографии с масс-спектрометрическим детектором.
Тинидазол – антибактериальный препарат, который предназначен для лечения животных и птицы при заболеваниях, вызванных микроорганизмами, чувствительными к тинидазолу (балантидиоз у свиней, трихомоноз у коров и быков-производителей, лямблиоз у мелких домашних животных – собак и кошек, а также сальмонеллезе и гистомоноз кур, индеек, уток и гусей).
Тинидазол также широко используется и для лечения заболеваний у взрослых и детей. Соответственно, если человек постоянно употребляет в пищу мясную продукцию с содержанием этого препарата, то у него вырабатывается привыкание к данному виду антибиотика. В случае лечения требуются более сильные лекарственные средства с большими дозами.
Ещё один побочный эффект от применения продуктов, содержащих остатки лекарственных препаратов – аллергические реакции. Антибиотики в мясе могут также стать причиной снижения иммунитета, особенно у детей.
Тинидазол — не единственный препарат, на который стоит обратить внимание. В связи с тем, что группы применяемых антибиотиков у людей и животных в сельском хозяйстве одинаковы, все они могут вызвать нежелательный иммунитет к действию антибиотиков.
Специалисты ФГБУ «Ставропольская межобластная лаборатория» обнаружили в пробах печени цыплят бройлеров антибиотик – тинидазол.
Чтобы ветеринарные препараты не причиняли в последующем вреда человеку, специалисты ФГБУ «Ставропольская межобластная ветеринарная лаборатория» напоминают: использование антибактериальных препаратов в фермерских хозяйствах должно проводиться строго в соответствии с установленными нормами.
После введения антибиотика должен пройти определённый срок (для каждого препарата он прописывается отдельно), в течение которого лекарство выводится из организма животного. Только после этого можно допускать к реализации и употреблять продукцию животного происхождения.

 

Расскажите друзьям: Please enable JavaScript to view the comments powered by Disqus.

Брометронид НОВЫЙ №30 таблетки противопаразитарные Бровафарма

Инструкция по применению Брометронид НОВЫЙ таблетки №30 Бровафарма

Описание:

Таблетки для перорального применения.

Состав:

1 г препарата (1 таблетка) содержит тинидазол — 250 мг.

Описание:

Таблетки светло-желтого цвета.

Фармакологические свойства:

Тинидазол — синтетический препарат широкого спектра действия на простейших Balantidium coli, Entamoeba histolytica, Treponema hyodysenteriae, Histomonas meleagridis, Lamblia intestinalis, Eimeria spp., Trichomonas columbae, T. gallinae, бактерицидного действия на анаэробов Bacteroides spp., Fusobacterium spp., Clostridium spp., большинство видов грамположительных и грамотрицательных кокков и пр.

Быстро и почти полностью абсорбируется из ЖКТ. Максимальная концентрация в сыворотке крови достигается через 2 часа и сохраняется в течение 12 часов. Хорошо распределяется во всех тканях организма, биотрансформируется в печени. Около 60% препарата выводится с мочой, 12% — с калом.

Показания:

Лечение животных при заболеваниях, которые вызваны микроорганизмами, чувствительными к тинидазолу:

  • птица (голуби, декоративные фазаны) — гистомоноз, трихомоноз, эймериоз, сальмонеллез;
  • собаки, коты — лямблиоз, амебиаз, трихомоноз, другие анаэробные инфекции;
  • декоративные кролики — эймериоз.

Вид животных:

Собаки, Коты, Кролики, Фазаны, Голуби.

Способ применения и дозы:

Препарат применяют перорально.

Дозы препарата для различных видов животных приведены в таблице.

Вид животных и заболевания

Доза, таблетка

Применение

на 1 кг корма

на кг массы тела

Птица (голуби, декоративные фазаны)

лечение

2 (измельчить)

10 дней

Собаки:

лямблиоз, амёбиаз

1 на 20-25 кг

5 дней

анаэробные инфекции

1 на 18-20 кг

2-3 недели

Коты:

лямблиоз, трихомоноз

¼ на 5 кг

10 дней

Декоративные кролики:

эймериоз (взрослые животные)

¼ на 1 кг

3 дня

при отлучении от матери (молодняк)

¼ на 2 кг

10 дней

Предостережения:

У животных, чувствительных к тинидазолу, могут возникать аллергические реакции в виде лихорадки, крапивницы, рвоты. После отмены препарата эти симптомы исчезают без специального лечения.

Противопоказания:

Не назначать животным, чувствительным к тинидазолу, с нарушениями функций печени и почек, в последнюю треть беременности.

Условия хранения:

В сухом, темном, недоступном для детей месте при температуре от +8 до +25 °С.

Срок годности:

3 года.

4 симптомов лямблиоза у кошек

Правильное питание, умеренные физические нагрузки и любовь хозяев еще не гарантируют стабильность в самочувствии вашей кошки или кота. Важно присматриваться к питомцу внимательнее, чтобы не пропустить возникновение заболеваний. Любимец резко стал терять в весе, и вдруг появился жидкий стул? Это может быть лямблиоз – заболевание тонкого кишечника. Каковы симптомы и лечение лямблиоза у кошек? Подробнее в данной статье.

Что это такое?

Лямблией называют микроорганизмы, паразитирующие в отделах тонкого кишечника не только у кошачьих, но и у многих других животных. Носителями этих простейших могут быть грызуны, птицы, собаки и даже человек.

© shutterstock

С помощью специального диска-присоски, расположенной на животе, лямблии прикрепляются к слизистой кишечника и размножаются, вовсю питаясь переваренной пищей хозяина. Путешествуя по кишечнику в двух формах – трофозоид(форма лямблии, способная к размножению) и циста(устойчивая форма с оболочкой, вроде «куколки» бабочек), паразиты могут жить в кошачьем организме, а также в почве и воде много месяцев.

Эти лямблии очень живучи: они не погибают днем под действием УФ-лучей, их не берет дезинфекция помещения хлором. Только понижение влажности способно погубить данные существа. Выходят они из кошачьего организма вместе с фекалиями, что крайне опасно, так как хозяин нередко сам заражается лямблиозом.

Пути попадания лямблий в организм

Небольшого количества лямблий вполне достаточно для заражения животного. Происходит этот процесс фекально-оральным способом. Кот мог выпить зараженную воду, либо умыть морду, после посещения лотка, в котором размножились микроорганизмы. При заражении питомец проглатывает именно цисту, которая потом прорывается под действием желудочного сока, и лямблия, уже в активной форме трофозоида, начинает свое размножение, вызывая симптомы заболевания.

Опасность лямблиоза у кошек

Лямблии у кота раздражают слизистую кишечника, нарушают функцию выделения секрета, замедляют все моторные процессы в ЖКТ животного. Кроме того, эти паразиты мешают всасыванию полезных веществ, принуждая организм вашего любимца поглощать не нужные витамины и микроэлементы, а продукты своей жизнедеятельности. Они вызывают аллергию и интоксикацию у животного.

© shutterstock

Лечение лямблиоза у кошек нужно начинать сразу же, как только появились первые признаки изменения самочувствия животного. Ведь накопление лямблий травмирует стенки желудка и приводит к язвам, в также эрозиям. Питомец может приобрести хронический панкреатит, заработать авитаминоз и дисбактериоз, а то и вовсе погибнуть от обезвоживания, так как диарея при лямблиозе постоянно дает о себе знать.

Симптоматика заболевания

Диагностика лямблиоза включает в себя обязательное появление у животного следующих симптомов:

  1. Кишечные расстройства. Стул имеет водянистую консистенцию. Может быть бледно-желтым, зеленоватым и с затхлым запахом. В особо запущенных формах в кале кошки присутствует слизь и кровь.
  2. Общее недомогание. Всегда активный питомец вдруг становится сонным и вялым. Этот симптом может вовсе не проявляться.
  3. Снижается вес. Основной симптом, на который обращают внимание в первую очередь. При этом аппетит, как правило, не меняется. Наоборот, кот или кошка могут начать есть еще больше, так как, накапливаясь, лямблии начинают вызывать постоянное чувство голода у животного.
  4. Внезапные аллергические проявления. Продукты жизнедеятельности лямблий токсичны, поэтому не исключены насморк и кожные высыпания. Эти симптомы крайне индивидуальны.

Иногда лямблиоз проходит без всех этих симптомов, и единственное, что «выдает» питомца — это постоянный дикий аппетит и характерные почесывания в районе желудка.

Как обнаружить паразитов?

Кроме симптоматической составляющей при постановке диагноза ветеринар пользуется специальным анализом – сдача кала или фекального мазка на содержание простейших, в то числе и лямблий. Цисты или трофозоиды лямблий не всегда выходят из организма кота, поэтому данный анализ делают в течение нескольких дней, каждый раз обрабатывая пробы под микроскопом.

© shutterstock

Так как лечение лямблий у котов и собак достаточно популярно, то был придуман специальный тест на обнаружение только этих паразитов в организме животного – имунноферментный анализ(ИФА) или имуннохроматографический тест(ИХ). Делают его в любой ветеринарной клинике, в лаборатории.

Способы лечения

Особенности лечения лямблиоза у котов всегда сопряжены с фазами заболевания. Чем раньше приняты меры по уничтожению паразитирующих микроорганизмов, тем легче ваш любимец избавится от этой напасти.

При первых же симптомах животное сразу нужно отвести к врачу и не заниматься самолечением, так как даже опытный ветеринар не сразу может поставить диагноз, опираясь только на симптомы заболевания.

Лямблии – паразитирующие существа, поэтому лечатся назначением антигельминтов( противопаразитарных препаратов) и антибиотиков. Для котов используют метронидазол, либо тинидазол и фуразолидон. Если состояние животного уже критическое, то его помещают в стационар и дают комбинацию таких лекарств.

Вместе с антигельминтными препаратами врач пропишет вашему любимцу энтеросорбенты, которые помогут остановить процесс интоксикации после уничтожения лямблий, а также пробиотики. Они восстановят загубленную паразитами микрофлору кишечника кота, а также нормализуют стул и работу всего ЖКТ.

© shutterstock

Кроме того, во время лечения лямблиоза показана специальная диета, которая исключает все жирные сорта мяса и рыбы, а также продукты с хозяйского стола, например, колбасу. Диета разрабатывается для питомца ветеринаром с учетом особенностей его обычного кормления и часто включает в себя:

  • Отварную курицу;
  • Нежирные сорта рыба и мяса, сделанные на пару;
  • Отсутствие кисло-молочных продуктов;
  • Термически обработанные овощи: например, картофельное пюре, морковь и т.д.
  • Каши на нежирном мясном бульоне или воде.

Курс лечения лямблиоза длится от одной до двух недель. Дозировку и часы приема препаратов для кота или кошки нужно согласовать с врачом, либо пользоваться инструкцией к лекарственному средству.

После лечения делается повторный анализ на обнаружение лямблий. Огромным минусом в лечении лямблиоза именно у представителей кошачьего семейства является то, что лямблии у кошек обладают большой сопротивляемостью, нежели, к примеру, у собак. Поэтому часто требуются повторные курсы лечения и замена тех препаратов, к которым уже выработался «иммунитет» у паразитов.

Профилактика заболевания

Может ли кошка заразить своего хозяина? Теоретически нет, так как видов лямблий огромное количество, и кошачьи лямблии – это отдельный биологический вид, отличный от тех, которые свойственны человеческой форме заболевания. Однако, в медицинской практике зафиксировано много случаев заражения человека лямблиозом, причиной которого становится тесное общение с представителями животного мира, к примеру, со своей любимой кошкой или котом.

Поэтому важным правилом профилактических мер является гигиена. Чаще мойте руки, особенно после уборки кошачьего лотка, дезинфицируйте поверхности, по которым ходит ваш питомец моющими средствами и вытирайте насухо, чтобы лямблии не получали подходящую для них влажную среду.

Обрабатывайте кипятком всю кошачью посуду, так как в кипятке лямблии сразу же гибнут, находясь в любой форме! И конечно же следите за своим любимцем: не допускайте контакта с больными животными и хорошо промывайте шерсть кота при купании.

Таким образом, диагноз «лямблиоз» у вашего питомца отнюдь не является приговором. При появлении первых симптомов сразу же отправляйтесь к врачу, который подберет правильные антигельмитные препараты и назначит соответствующую диету.

Не теряйте время, так как в запущенных формах лямблиоза вашему любимцу может грозить гибель! Соблюдайте гигиену жилища, чаще мойте руки, особенно после уборки кошачьего туалета. Не забывайте купать вашего кота или кошку чаще, а также необходимо обрабатывать кипятком все миски животного. При таком образе жизни лямблиоз будет не страшен!

Эффективность тинидазола для лечения кошек, экспериментально инфицированных Tritrichomonas fetus

Цель: Определить эффективность тинидазола для лечения кошек с экспериментально индуцированной тритрихомонадной инфекцией плода.

Животные: 8 котят, свободных от специфических патогенов.

Процедуры: Тинидазол тестировали на активность в отношении кошачьего изолята T fetus in vitro. Котят заражали через рот тем же изолятом и лечили или не лечили тинидазолом (30 мг/кг, перорально, каждые 24 часа в течение 14 дней). Амоксициллин вводили через 28 недель после завершения приема тинидазола, чтобы вызвать диарею. Фекалии повторно тестировали на T fetus с использованием анализа ПЦР и микробной культуры в течение 33 недель.

Результаты: Тинидазол убивал Т-плод в концентрациях > или = 10 мкг/мл in vitro. При экспериментально индуцированной инфекции тинидазол, вводимый в дозе 30 мг/кг, снижал Т плода ниже предела молекулярного обнаружения у 2 из 4 кошек. Повторное выделение T foetus, вызванное диареей, вызванной амоксициллином, было уменьшено у кошек, ранее получавших тинидазол.

Выводы и клиническая значимость: Несмотря на то, что тинидазол уменьшал обнаружение T плода, а леченные кошки были устойчивы к более поздним попыткам спровоцировать инфекцию, неспособность тинидазола искоренить инфекцию у многих кошек представляет собой серьезное препятствие для эффективности препарата на практике.

(PDF) Эффективность тинидазола для лечения кошек, экспериментально инфицированных Tritricchomonas fetus

1086 AJVR, Vol 68, No.10, October 2007

Аликвоту разбавляли и фиксировали в 0,9 мл 10%

формальдегида, поскольку трудно точно подсчитать живые организмы с быстрой подвижностью. Подсчет клеток проводили с помощью гемоцитометра и представляли как

среднее значение ± стандартное отклонение для каждого тройного разведения. Через 72 часа 1

пробирки для первичной культуры при каждом разведении центрифугировали

и 0,1 мл осажденных организмов субкультивировали в

10 мл среды, не содержащей противомикробных препаратов.Через 24 часа

аликвоту 10 мкл каждой субкультуры исследовали с помощью световой микроскопии

на наличие подвижных трихомонад.

Восприимчивость T плода к данной концентрации препарата определяли

по отсутствию репликации в первичной культуре в течение

72-часового периода и неспособности микроорганизмов к репликации

после переноса на безантимикробную среду.

Экспериментально индуцированная инфекция — специфическая

7-недельные нетронутые половозрелые самки (n = 4)

и самцы (4) домашних короткошерстных кошек были приобретены

у коммерческого поставщика

c

и кормили сухим кормом

d

по желанию

на протяжении всего исследования.Вкладыши в клетку очищали

, и каждый день устанавливали новый лоток. Кошек

переводили в вновь продезинфицированные клетки каждые 1-

2 недели. Кошки содержались в условиях контролируемого освещения и температуры,

содержались в соответствии с рекомендациями 2-го уровня биобезопасности. Комитет по уходу и использованию

Государственного университета Северной Каролины

одобрил этот протокол.

В течение начального 7-недельного периода акклиматизации

каждая кошка была признана здоровой на основании

еженедельного физического осмотра и результатов общего анализа крови. Fe-

Калькуляционное исследование для каждой кошки включало тестирование на антиген

Giardia spp. на каждую из 2 проб фекалий/кошку).

Инокуляция плода Т. Каждой кошке вводили

седативное средство с кетамином (11 мг/кг, внутривенно) и мидазоламом (0,15

мг/кг, внутривенно) и получали 3 мл среды, содержащей примерно

примерно 2 X 10

6

живой Т плод через орогастральный зонд.

Тинидазол. Лечение тинидазолом было начато через 4 недели после индуцированной инфекции. В то время кошки

были разделены на пары на основе массы тела на 2 группы

, содержащие равное количество самцов и самок.Группы

и

размещали в противоположных концах одной и той же комнаты, а группы

и

— в индивидуальных клетках. Таблетки тинидазола

f

(250 мг) были

четвертинками, а кошки группы А получали 62,5 мг (1/4 таблетки

лет) перорально один раз в день в течение 14 дней. Фактические дозы варьировались от 26 до 30 мг/кг. Кошки группы B не получали

тинидазола или плацебо. Введение тинидазола

и определение того, какая группа получала лечение, были ограничены 1 исследователем (JLG).Все диагностические пробы

были закодированы персоналом, не участвующим в анализе или интерпретации

.

Выявление инфекции Т-плода. Для

ПЦР-анализа или посева

фекалии собирали из

толстой кишки каждой кошки с помощью ректальной петли еженедельно в течение

3-недельного периода между индукцией инфекция

и начало лечения, дважды во время лечения,

и 28 раз в течение 33-недельного периода после завершения лечения

.В течение этого 33-недельного периода для каждой кошки был протестирован 21 образец фекалий с помощью анализа ПЦР

и 10 образцов фекалий были протестированы с помощью посева на

T плода. На 28-й неделе после лечения всех кошек в группе

А и группе В индуцировали антимикробную диарею путем введения 250 мг

амоксициллина перорально дважды в день в течение 2 дней. Фактические дозы

варьировались от 54 до 88 мг/кг. Фекалии собирали

через 24 и 72 часа для микроскопического исследования

мазка

, микробной культуры фекалий в имеющейся в продаже среде

,

г

и однопробирочного ПЦР-анализа

для обнаружения T единица гена рРНК плода с использованием

видоспецифичных праймеров.

11

ПЦР-анализ — ДНК была извлечена из каждого

образца фекалий и подвергнута ПЦР-амплификации

последовательности гена бактериальной 16S рРНК длиной 876 п.н. генная единица рРНК

, как описано.

8

Путем проведения ПЦР-анализа

бактериального гена 16S рРНК была исключена возможность того, что отрицательный результат ПЦР-анализа

T плода может быть связан с

присутствием эндогенных ингибиторов ПЦР в экстрагированной

ДНК. для каждого образца.

На 29-й неделе после лечения кошек группы А исследование

было разоблачено, и кошки группы В получали 125 мг

тинидазола перорально один раз в день в течение 14 дней. Фактические дозы

варьировались от 27 до 44 мг/кг. Анализ ПЦР

проводили еженедельно в течение 3 недель после лечения. После завершения лечения

фекалии собирали из толстой кишки кошек группы В и группы А с помощью ректальной петли

еженедельно в течение дополнительных 3 недель.Всех кошек снова

индуцировали противомикробной

диареей путем введения 250 мг амоксициллина

перорально два раза в день в течение 2 дней. Фекалии были собраны

через 24 и 72 часа для микроскопического исследования

мазка фекалий, микробной культуры фекалий в имеющейся в продаже среде

,

г

и однопробирочного ПЦР-анализа

для обнаружения T. единица гена рРНК плода с использованием

видоспецифичных праймеров.

11

Результаты

Чувствительность in vitro — тинидазол останавливал рост

T fetus in vitro при концентрациях ≥ 10 мкг/мл (рис.

ure 1). Трихомонады не размножались после переноса

из пробирок, содержащих ≥ 1 мкг тинидазола/мл, в среду без лекарственного средства

.

Инфекция Tritrichomonas fetus — ни у одной кошки не было положительных результатов на T плод или Giardia sp до экспериментальной

индуцированной инфекции.Фекалии от каждой кошки неоднократно

были положительными на T плода с помощью ПЦР в течение 3

недель после заражения. Ни у одной кошки не развилась диарея

в результате инфекции. В фекалиях от каждой нелеченой кошки

(группа B) положительные результаты ПЦР-анализа для T плода наблюдались периодически на протяжении всего исследования (среднее значение ±

SD процент положительных результатов на кошку, 43 ± 2,1%; диапазон,

27 % до 60%). У 3 кошек из группы В фекальные культуры также

периодически были положительными на T плода.Однако посев был менее эффективен, чем анализ ПЦР для выявления инфекции

(среднее значение ± стандартное отклонение в процентах положительных результатов анализа фекалий

на кошку, 21 ± 1%; диапазон от 0% до 33%).

Эффект тинидазола. У всех 4 кошек, получавших тинидазол (группа А), были отрицательные результаты на Т-

инфекцию плода на основании результатов анализа ПЦР в течение 3 дней после начала лечения. У 1 кошки продукт амплификации

, соответствующий Т-плоду, наблюдался после ПЦР-анализа

ДНК, выделенной из фекалий через 6 и 8 недель после лечения-

Тинидазол — обзор | ScienceDirect Topics

Нитроимидазолы

Нитроимидазолы метронидазол и тинидазол (рис.42.8) являются препаратами выбора для лечения лямблиоза, амебиаза и трихомониаза. Клиническая фармакология метронидазола подробно обсуждается в главе 28. Тинидазол одобрен FDA для лечения трихомониаза, лямблиоза, а также кишечной и внекишечной инфекции. Хотя точный механизм его действия неизвестен, имеющиеся данные указывают на то, что он действует так же, как метронидазол, за счет нитрорадикалов, образующихся при метаболизме препарата в организме-мишени.Помимо активности в отношении простейших, тинидазол, как и метронидазол, обладает активностью in vitro в отношении анаэробных бактерий, включая микроорганизмы, связанные с бактериальным вагинозом ( Gardnerella vaginalis , Bacteroides spp. , и Prevotico spp.) и Hel. пилори .

Тинидазол доступен только для приема внутрь в виде таблеток по 250 и 500 мг и в виде сиропа. Биодоступность отличная, всасывание практически полное.Метаболизируется в печени CYP3A4; его преимущество перед метронидазолом заключается в более длительном периоде полувыведения из плазмы (12-14 часов против 8 часов 171 ).

При однократном введении в дозе 50 мг/кг (максимум 2 г) эффективно лечит лямблиоз. В метаанализе исследований, в которых однократная доза (50 мг/кг) тинидазола сравнивалась с метронидазолом, назначаемым три раза в день в течение 5–10 дней, 172 однократная доза тинидазола оказалась более эффективной.Однако авторы отметили, что исследования были небольшими, в которых приняли участие всего 179 человек, и имели низкое качество.

В отношении кишечного амебиаза метаанализ 173 восьми исследований с участием 477 человек показал, что тинидазол, назначаемый в дозе 2 г один раз в день в течение 3 дней, был значительно эффективнее метронидазола и вызывал меньше побочных эффектов. Точно так же тинидазол оказался не менее эффективным, чем метронидазол, для лечения амебных абсцессов печени и лучше переносился. 174

Для лечения трихомониаза тинидазол не менее эффективен, чем однократная доза метронидазола. 175 В мета-анализе восьми исследований, в которых метронидазол сравнивали с тинидазолом, хотя не сообщалось о паразитологических неудачах, среди тех, кто лечился метронидазолом, наблюдались значительно более высокие показатели лечения, клинической неудачи и побочных эффектов. Тинидазол может играть определенную роль у пациентов, у которых терапия метронидазолом оказалась неэффективной. В исследованиях, сравнивающих тинидазол с метронидазолом для лечения бактериального вагиноза, сообщалось об аналогичных показателях излечения. 176

Сообщаемые побочные эффекты при приеме тинидазола в целом аналогичны тем, о которых сообщалось при приеме метронидазола, хотя, как правило, менее частые или тяжелые. К ним относятся металлический привкус, желудочно-кишечные расстройства (анорексия, тошнота, рвота и дискомфорт в эпигастрии) и слабость. При применении тинидазола сообщалось о судорогах и периферической нейропатии. Тинидазол противопоказан в первом триместре беременности и пациентам с аллергией на метронидазол.

Нитроимидазол – обзор | ScienceDirect Topics

Нитроимидазолы

Нитроимидазолы метронидазол и тинидазол (рис.42.8) являются препаратами выбора для лечения лямблиоза, амебиаза и трихомониаза. Клиническая фармакология метронидазола подробно обсуждается в главе 28. Тинидазол одобрен FDA для лечения трихомониаза, лямблиоза, а также кишечной и внекишечной инфекции. Хотя точный механизм его действия неизвестен, имеющиеся данные указывают на то, что он действует так же, как метронидазол, за счет нитрорадикалов, образующихся при метаболизме препарата в организме-мишени.Помимо активности в отношении простейших, тинидазол, как и метронидазол, обладает активностью in vitro в отношении анаэробных бактерий, включая микроорганизмы, связанные с бактериальным вагинозом ( Gardnerella vaginalis , Bacteroides spp. , и Prevotico spp.) и Hel. пилори .

Тинидазол доступен только для приема внутрь в виде таблеток по 250 и 500 мг и в виде сиропа. Биодоступность отличная, всасывание практически полное.Метаболизируется в печени CYP3A4; его преимущество перед метронидазолом заключается в более длительном периоде полувыведения из плазмы (12-14 часов против 8 часов 171 ).

При однократном введении в дозе 50 мг/кг (максимум 2 г) эффективно лечит лямблиоз. В метаанализе исследований, в которых однократная доза (50 мг/кг) тинидазола сравнивалась с метронидазолом, назначаемым три раза в день в течение 5–10 дней, 172 однократная доза тинидазола оказалась более эффективной.Однако авторы отметили, что исследования были небольшими, в которых приняли участие всего 179 человек, и имели низкое качество.

В отношении кишечного амебиаза метаанализ 173 восьми исследований с участием 477 человек показал, что тинидазол, назначаемый в дозе 2 г один раз в день в течение 3 дней, был значительно эффективнее метронидазола и вызывал меньше побочных эффектов. Точно так же тинидазол оказался не менее эффективным, чем метронидазол, для лечения амебных абсцессов печени и лучше переносился. 174

Для лечения трихомониаза тинидазол не менее эффективен, чем однократная доза метронидазола. 175 В мета-анализе восьми исследований, в которых метронидазол сравнивали с тинидазолом, хотя не сообщалось о паразитологических неудачах, среди тех, кто лечился метронидазолом, наблюдались значительно более высокие показатели лечения, клинической неудачи и побочных эффектов. Тинидазол может играть определенную роль у пациентов, у которых терапия метронидазолом оказалась неэффективной. В исследованиях, сравнивающих тинидазол с метронидазолом для лечения бактериального вагиноза, сообщалось об аналогичных показателях излечения. 176

Сообщаемые побочные эффекты при приеме тинидазола в целом аналогичны тем, о которых сообщалось при приеме метронидазола, хотя, как правило, менее частые или тяжелые. К ним относятся металлический привкус, желудочно-кишечные расстройства (анорексия, тошнота, рвота и дискомфорт в эпигастрии) и слабость. При применении тинидазола сообщалось о судорогах и периферической нейропатии. Тинидазол противопоказан в первом триместре беременности и пациентам с аллергией на метронидазол.

Ципрофлоксацин — Список лекарств и рецептов для домашних животных, собак и кошек

Информация о лекарствах

  • Название лекарства: Ципрофлоксацин
  • Общее название: Cipro®, Ciloxan®
  • Тип лекарства: Хинолоновый антибиотик
  • Используется для: бактериальных инфекций
  • Виды: Собаки, Кошки
  • Применяется: инъекционный, 22.Таблетки по 7 мг и 68 мг, Ушные лекарства
  • Способ отпуска: только по рецепту
  • Одобрено FDA: Нет

Общее описание


 

Ципрофлоксацин — антибиотик, используемый для лечения сложных бактериальных инфекций у домашних животных. Он эффективен как против грамотрицательных, так и против грамположительных бактерий. Он обычно используется при инфекциях мочевыводящих путей, кожных инфекциях и респираторных инфекциях. Существуют доступные формы, предназначенные для лечения ушных и глазных инфекций.

Как и в случае с любым антибиотиком, убедитесь, что вы закончили прием всех назначенных лекарств, даже если симптомы больше не проявляются.

Как это работает

Ципрофлоксацин препятствует транскрипции ДНК бактериями. Ципрофлоксацин делает невозможным чтение или раскручивание ДНК ферментом, связанным с этой задачей, что убивает бактерии.

Информация о хранении

 

Хранить в плотно закрытой таре при комнатной температуре.

Пропущенная доза

Дайте дозу как можно скорее. Если почти пришло время для следующей дозы, пропустите пропущенную дозу и продолжайте прием по обычному графику. Не давайте вашему питомцу две дозы сразу.

Побочные эффекты и реакции на лекарства

Ципрофлоксацин может вызвать следующие побочные эффекты:

  • Потеря аппетита
  • Рвота
  • Диарея
  • Летаргия
  • Конвульсии
  • Судороги у домашних животных с расстройствами ЦНС
  • Катаракта при длительном применении

Ципрофлоксацин может реагировать со следующими препаратами:

  •  Аминогликозидные антибиотики
  • Антациды
  • Цефалоспориновые антибиотики
  • Римадил (и другие НПВП)
  • Пенициллин
  • Аминофиллин
  • Циклоспорин
  • Нитроурантоин
  • Сукральфат
  • Теофиллин

НЕ ДАВАЙТЕ ЭТОТ ПРЕПАРАТ БЕРЕМЕННЫМ ЖИВОТНЫМ — Ципрофлоксацин оказывает вредное воздействие на растущие суставы и кости.

НЕ ДАВАЙТЕ ЭТО ПРЕПАРАТ СОБАКАМ В ВОЗРАСТЕ ДО ОДНОГО ГОДА — Ципрофлоксацин оказывает вредное воздействие на растущие суставы и кости. Это может повлиять на собак крупных пород в возрасте от 2 лет.

БУДЬТЕ ОСТОРОЖНЫ ПРИ ВВЕДЕНИИ ЭТОГО ПРЕПАРАТА КОШКАМ — Используйте с особой осторожностью и только по рекомендации опытного ветеринара при назначении этого препарата кошкам, особенно тем, у которых ранее была почечная недостаточность.

БУДЬТЕ ОСТОРОЖНЫ ПРИ ВВЕДЕНИИ ЭТОГО ПРЕПАРАТА ЖИВОТНЫМ С ЗАБОЛЕВАНИЕМ ПОЧЕК, ЗАБОЛЕВАНИЕМ ПЕЧЕНИ, ЗАБОЛЕВАНИЕМ ЦЕНТРАЛЬНОЙ НЕРВНОЙ СИСТЕМЫ ИЛИ ЭПИЛЕПСИЕЙ

Дисбактериоз фекальной микробиоты у кошек с природной и экспериментально индуцированной тритрихомонадной инфекцией плода

Abstract

Протозойный патоген Tritrichomonas fetus поражает толстую кишку домашних кошек и является основной причиной хронического колита и диареи.Неэффективность лечения является обычным явлением, но антибиотики могут улучшать клинические симптомы у некоторых кошек, что заставляет исследователей сомневаться в участии микробиоты толстой кишки в патогенезе заболевания. Исследования, проведенные на женщинах с венерическими инфекциями Trichomonas vaginalis , показали, что дисбиоз микробиоты хозяина способствует патогенности с аналогичными результатами, обнаруженными также у мышей с кишечной инфекцией Trichomonas musculis . Целью этого исследования было охарактеризовать различия в фекальной микробиоте кошек с и не встречающиеся в природе T . заражение плода и в группе котят до и после экспериментально индуцированного заражения. Заархивированная фекальная ДНК кошек, прошедших тестирование на T . Инфекцию плодов (n = 89) и экспериментально инфицированных котят (n = 4; до, 2 недели и 9 недель после заражения) анализировали путем секвенирования генов 16S рРНК. Среди естественно инфицированной популяции роды Megamonas и Helicobacter были значительно повышены по распространенности и численности у кошек, давших положительный результат на T . плод инфекция. В группе из четырех экспериментально инфицированных котят образцы фекалий после заражения имели значительно более низкую численность представителей рода Dialister и Megamonas и большую численность класса Betaproteobacteria и семейства Succinivibrionaceae . Мы предполагаем, что T . плод способствует дисбактериозу за счет конкуренции за ферментируемые субстраты, используемые этими бактериями, и что побочные продукты метаболизма могут способствовать патогенезу воспаления толстой кишки и диареи.Будущие исследования необходимы для измерения фекальных концентраций микробных и протозойных метаболитов у кошек с T . плод инфекции для выявления потенциальных терапевтических целей.

Образец цитирования: Bierlein M, Hedgespeth BA, Azcarate-Peril MA, Stauffer SH, Gookin JL (2021)Дисбиоз фекальной микробиоты у кошек с естественной и экспериментально индуцированной инфекцией Tritrichomonas fetus . ПЛОС ОДИН 16(2): e0246957.https://doi.org/10.1371/journal.pone.0246957

Редактор: Хуан Дж. Лоор, Иллинойский университет, США

Поступила в редакцию: 4 декабря 2020 г .; Принято: 28 января 2021 г .; Опубликовано: 19 февраля 2021 г.

Авторское право: © 2021 Bierlein et al. Это статья с открытым доступом, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

Доступность данных: Все файлы последовательностей доступны в базе данных NCBI Sequence Read Archive (номер доступа PRJNA692480 и PRJNA692463) https://www.ncbi.nlm.nih.gov/bioproject/PRJNA692463 https://www.ncbi .nlm.nih.gov/bioproject/PRJNA692480.

Финансирование: Эти исследования были поддержаны Фондом Пола и Леа Левин (JLG) и Фондом поддержки исследований и инноваций T. fetus Фонда ветеринарной медицины Северной Каролины в ветеринарном образовании (NCVMF-STRIVE) (JLG).Ядро микробиома UNC частично поддерживается P30 DK034987 Центром биологии и болезней желудочно-кишечного тракта (CGIBD) и P30 DK056350 Исследовательским центром ожирения UNC (NORC). Спонсоры не участвовали в разработке исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Конкурирующие интересы: Авторы заявили об отсутствии конкурирующих интересов.

Введение

Tritrichomonas fetus является частой причиной хронического колита и диареи у домашних кошек во всем мире [1–6].Известно, что инфекции, вызванные этим простейшим, трудно поддаются лечению, поскольку многие изоляты устойчивы к современным методам лечения, а рецидивы распространены [7–9]. Трихомонады являются облигатными паразитами или комменсалами анаэробных полостей тела, выстланных слизистой оболочкой, таких как желудочно-кишечный тракт и репродуктивный тракт. Эти простейшие вызывают заболевание с помощью различных механизмов, включая нарушение микроокружения слизистой оболочки [10, 11], адгезию и деградацию слизистого барьера [12], индукцию эпителиального апоптоза [13, 14] и уклонение от иммунной системы хозяина [12]. 15, 16].У кошек T . Инфекция fetus передается фекально-оральным путем и в конечном итоге ограничивается толстой кишкой, где микроорганизмы живут в смеси с кишечными бактериями в непосредственной близости от слизистой оболочки [2, 17]. Наличие инфекции приводит к лимфоцитарному, плазмоцитарному и нейтрофильному колиту и хронической, часто пожизненной, диарее [18].

Исследования у женщин с венерическими простейшими Trichomonas vaginalis указывают на то, что дисбиотическая вагинальная микробиота опосредует не только патогенные эффекты инфекции, но и предрасположенность к инфекции [19–22].Дисбиотические бактерии служат патобионтами, которые усиливают патогенность, способствуя адгезии T . vaginalis к клеткам шейки матки [21] и увеличению парацеллюлярной проницаемости [20]. У лабораторных мышей на колонизацию кишечника комменсалом Tritrichomonas musculis влияют конкурентные и кооперативные отношения с представителями кишечной микробиоты в отношении побочных продуктов метаболизма [23]. Трихомонады зависят от получения микроэлементов из среды хозяина, а также могут охотиться на бактерии-хозяева посредством фагоцитоза [24].В настоящее время ни одно исследование не изучало воздействие T . Инфекция плода на кишечную микробиоту кошек. Эта взаимосвязь особенно интересна, поскольку лечение антибиотиками может улучшить клинические признаки диареи у некоторых кошек с T . заражение плода одновременно провоцирует рецидив диареи у других [1, 3, 9].

Наша цель в этом исследовании состояла в том, чтобы охарактеризовать влияние природного и экспериментально введенного T .Инфекция fetus на микробиоту толстой кишки кошек с использованием секвенирования гена 16S рРНК на основе Illumina из архивной фекальной ДНК. Мы предположили, что кошки с T . Инфекция плода будет иметь дисбиоз определенных членов фекальной микробиоты, характеристики которых могут дать представление о патогенезе заболевания и целях для лечения.

Методы

Образцы фекальной ДНК

Кошки, проходящие ПЦР-тестирование для диагностики природного
T . плод инфекция.

Архивная ДНК была идентифицирована в образцах фекалий, представленных для T . плод ПЦР-тестирование в Исследовательской лаборатории кишечных патогенов Университета штата Северная Каролина в период с 2012 по 2017 год. Экстракция ДНК проводилась с использованием набора для экстракции ДНК Zymo Fecal/Soil (Zymo Research, Irvine CA), как описано ранее [25]. Все образцы ДНК хранились при температуре -20°C до использования в текущем исследовании. Недавно было опубликовано полное описание родительской популяции, из которой были отобраны эти выборки [26].Критериями включения в это исследование были образцы, первоначально сопровождаемые формой представления, в которой была представлена ​​история лечения или указание на отсутствие лечения. Дополнительная информация о пациенте, извлеченная из форм подачи, включала породу, возраст, жизненный этап [27], пол, метод сбора фекалий (выделение, петля, ободочная промывка), а также показания и результаты T . плод ПЦР-тестирование. Как описано ранее [5], петлевые сборы осуществляются путем введения фекального петлевого устройства через задний проход в толстую кишку для сбора фекального образца.Промывка толстой кишки выполняется путем введения красного резинового катетера размером 8–10 по шкале Франции через задний проход и закапывания физиологического раствора в проксимальный отдел толстой кишки для образования фекальной суспензии. Материал суспензии собирают, а осадок используют в качестве образца фекалий. Образцы исключались из исследования, если не была предоставлена ​​история лечения или если в истории лечения сообщалось о каком-либо предшествующем применении антимикробных или противогельминтных препаратов.

Котята, экспериментально инфицированные кошачьими
T . плод .

Архивная ДНК была идентифицирована в образцах фекалий, взятых у котят до и после экспериментального заражения T . плодов в 2006 г. [28]. Экстракцию ДНК проводили с использованием мининабора QIAamp DNA Stool (Qiagen) с небольшими модификациями, как описано ранее [29]. Все образцы ДНК хранились при температуре -20°C до использования в текущем исследовании. Для экспериментальной инфекции у одного и того же продавца (Liberty Laboratories, Liberty, NY) были приобретены четыре 7-недельных половых интактных котенка мужского пола (n = 2) и женского пола (n = 2) в возрасте 7 недель.Каждый котенок содержался в отдельной клетке в одном и том же лабораторном животноводческом комплексе и получал один и тот же сухой корм ad libitum (Hill’s Science Diet Feline Growth) на протяжении всего исследования. После семинедельного периода акклиматизации и в возрасте 14 недель котят заражали одним изолятом T . плод , выращенный из фекалий кошки с диареей [28]. Каждому котенку прививали 2 x 10 6 T . плод путем орогастральной интубации.В это исследование включены образцы ДНК, извлеченные из фекалий, собранных у каждого котенка с помощью фекальной петли до заражения, а также через 2 и 9 недель после заражения. Исследование было одобрено Комитетом по институциональному уходу и использованию животных Университета штата Северная Каролина № 03-095B. Из-за невозможности впоследствии искоренить индуцированную инфекцию кошек усыпили путем внутривенной инъекции пентобарбитала по завершении первоначального исследования.

Бактериальная амплификация и секвенирование гена 16S рРНК

Экстрагированная ДНК была определена количественно с помощью анализа PicoGreen и использована для секвенирования бактериального ампликона гена 16S рРНК.Тотальную ДНК (12,5 нг) амплифицировали с использованием универсальных праймеров, нацеленных на область V4 бактериального гена 16S рРНК [30]. Последовательности праймеров были следующими: 515F — 5′ TCGTCGGCAGCGTCA GATGTGTATAAGAGACAGGTGCCAGCMGCCGCGGTAA 3′ и 806R — 5’GTCTCGTGGGCTCGGAGATGT GTATAAGAGACAGGGACTACHVGGGTWTCTAAT 3′. К 5′-концу каждой последовательности праймеров присоединяли выступающие адаптеры для совместимости с платформой для секвенирования Illumina. Мастер-миксы содержали 12,5 нг общей ДНК, 0,2 мкМ каждого праймера и 2× KAPA HiFi HotStart ReadyMix (KAPA Biosystems, Уилмингтон, Массачусетс).Термический профиль для амплификации каждого образца включал начальную стадию денатурации при 95°C в течение 3 минут, за которой следовали 25 циклов денатурации при 95°C в течение 30 секунд, отжиг при 55°C в течение 30 секунд для 16S рРНК и 30 циклов денатурации при 95°C в течение 30 секунд. второе удлинение при 72°С, 5-минутное удлинение при 72°С и окончательная выдержка при 4°С. Каждый ампликон 16S очищали с использованием реагента AMPure XP (Beckman Coulter, Индианаполис, Индиана). На следующем этапе каждый образец амплифицировали с использованием программы ПЦР с ограниченным циклом, добавляя адаптеры для секвенирования Illumina и штрих-коды с двойным индексом (индекс 1 (i7) и индекс 2 (i5)) (Illumina, Сан-Диего, Калифорния) к мишени ампликона.Термический профиль для амплификации каждого образца включал начальную стадию денатурации при 95°C в течение 3 минут, за которой следовал цикл денатурации при 95°C в течение 30 секунд, отжиг при 55°C в течение 30 секунд и 30-секундное удлинение при 72°C. °C (8 циклов), 5-минутное удлинение при 72°C и окончательная выдержка при 4°C. Конечные библиотеки снова очищали с использованием реагента AMPure XP (Beckman Coulter), количественно определяли с помощью реагента Quant-iT™ PicoGreen® dsDNA Reagent (Molecular Probes, Thermo Fisher Scientific, Waltham, MA) и нормализовали перед эквимолярным объединением.Затем пул библиотеки ДНК денатурировали с помощью NaOH, разбавляли буфером для гибридизации и денатурировали нагреванием перед загрузкой в ​​прибор MiSeq с картриджем с реагентами MiSeq (Illumina). Автоматическое создание кластеров и секвенирование парных концов с двойным чтением выполняли в соответствии с инструкциями производителя.

Анализ данных секвенирования

Выходные данные секвенирования

с платформы Illumina MiSeq были преобразованы в формат fastq и демультиплексированы с использованием Illumina Bcl2Fastq 2.18.0.12.Полученные парные чтения были обработаны с использованием QIIME 2 [31] 2018.11. Последовательности праймеров индекса и линкера обрезали с использованием запуска cutadapt в QIIME 2. Полученные считывания парных концов обрабатывались с помощью DADA2 через QIIME 2, включая слияние парных концов, качественную фильтрацию, исправление ошибок и обнаружение химер. Единицам секвенирования ампликонов из DADA2 были присвоены таксономические идентификаторы по отношению к выпуску 13_08 Green Genes.

Оценки альфа-разнообразия были рассчитаны в рамках QIIME 2 с использованием индекса равномерности (Шеннона) и метрик количества наблюдаемых видов при глубине разрежения 5000 прочтений.Попарная значимость была протестирована с использованием дисперсионного анализа Крускала-Уоллиса со значениями q, скорректированными по Бенджамини-Хохбергу, рассчитанными, как реализовано в QIIME 2. Оценки бета-разнообразия были рассчитаны в QIIME 2 с использованием взвешенных и невзвешенных расстояний Unifrac, а также различий Брея-Кертиса между выборками при глубина подвыборки 5000 чтений. Результаты были обобщены, визуализированы с помощью анализа основных координат в Emperor, а значимость была оценена с помощью PERMANOVA с исправленными по Бенджамини-Хохбергом значениями q, рассчитанными в соответствии с QIIME 2.Дифференциально распространенные микробные таксоны были идентифицированы с помощью анализа состава микробиомов (ANCOM) в QIIME 2. Данные об относительной численности были нормализованы по размеру библиотеки образцов, и таксоны были удалены, если они присутствовали менее чем в 10% всех образцов или менее 0,01%. средняя численность [32]. Различия в численности были проверены на значимость с использованием одностороннего анализа дисперсии Краскела-Уоллиса по рангам. При значимости парные сравнения между группами проводились с использованием критерия Данна.Сгенерированные p-значения были скорректированы для многократного тестирования с использованием процедуры Бенджамини-Хохберга [33] с коэффициентом ложного обнаружения 0,15. Для выбранных таксонов отношение шансов и 95% доверительные интервалы для связи со статусом инфекции были рассчитаны с использованием критерия хи-квадрат с коррекцией непрерывности Йейтса. Статистическое исследование данных о численности проводилось с использованием программного обеспечения Systat (SigmaPlot 12.0, Сан-Хосе, Калифорния). Результаты были представлены графически с использованием программного обеспечения GraphPad (версия Prism 7.03, Сан-Диего, Калифорния).

Результаты

Кошки с встречающимся в природе

T . плод инфекция

Из 1717 архивных образцов ДНК, извлеченных из фекалий, представленных для T . плода ПЦР-тестирование, 89 образцов соответствовали критериям включения в исследование. Было представлено шестнадцать пород, в том числе домашние (46 кошек), бенгальские (11), абиссинские (7) и рэгдолл (6) чаще всего. Средний и средний возраст кошек составлял 3,7 и 1,7 года соответственно (диапазон от 3 месяцев до 16 лет).Большинство кошек были классифицированы по стадии жизни как младшие (28 кошек), затем котята (20 кошек), лучшие (19 кошек), взрослые (14 кошек), пожилые (2 кошки), гериатрические (1 кошка) или неизвестные. возраст (2 кошки). Полы включали кастрированных самцов (35 кошек), стерилизованных самок (24 кошки), интактных самок (16 кошек) и интактных самцов (14 кошек). Результаты испытаний T . fetus , клинические признаки, метод сбора образцов фекалий и история лечения кошек, образцы ДНК которых были включены в исследование, показаны в таблице 1.

Основные типы фекальной микробиоты кошек, проходящих тестирование на

T . Инфекции плода включают Firmicutes, Bacteroidetes, Proteobacteria, Fusobacteria и Actinobacteria

Анализ последовательностей всех 89 кошек дал 9 691 382 качественных последовательностей (среднее значение ± стандартное отклонение = 108 892 ± 21 089). Основные типы, представленные в фекальной микробиоте кошек, протестированы на T . Инфекция плода была Firmicutes, Bacteroidetes, Proteobacteria, Fusobacteria и Actinobacteria (рис. 1).

Рис. 1. Процентное содержание основных типов, наблюдаемое в фекалиях 89 отдельных кошек, прошедших тестирование на T . плод инфекция.

Каждый образец обозначается как полученный от кошки, анализ которой дал отрицательный результат против положительного на T . Инфекция плода по результатам ПЦР-тестирования кала.

https://doi.org/10.1371/journal.pone.0246957.g001

Не было никаких существенных различий в показателях равномерности альфа-разнообразия (Шеннон), разнообразия (Фейт) или наблюдаемого количества таксонов между кошками с положительными и отрицательными тестами. для Т . плод инфекция. Как взвешенные, так и невзвешенные измерения бета-разнообразия выявили небольшие, но значимые различия в филогенетическом составе микробиоты между кошками с положительным и отрицательным результатом теста на встречающийся в природе T . Инфекция плода (PERMANOVA, q <0,05) (рис. 2).

Рис. 2. Бета-разнообразие микробиоты 89 кошек, протестированных на естественную инфекцию T . плод .

Панель A: График анализа главных координат Брея-Кертиса, показывающий скопление микробных сообществ из фекалий кошек, положительный результат (синие кружки) по сравнению с отрицательным (красные круги) для T . плод инфекция. ось 1, 13,29%; ось 2, 7,427%; Ось 3, 6,032%. Панель B: Невзвешенные расстояния Unifrac между микробными сообществами и фекалиями при положительном и отрицательном тестировании на T . плод инфекция. ПЕРМАНОВА q = 0,033.

https://doi.org/10.1371/journal.pone.0246957.g002

Кошки дают положительный результат на

T . Инфекция fetus чаще относится к роду Megamonas и Helicobacter и имеет более высокую численность.

Изобилие специфических таксонов, обнаруженных в фекалиях кошек, при положительном и отрицательном результате теста на встречающийся в природе T .Инфекция плода показана в таблице 2.

После учета влияния множественных статистических сравнений кошки дали положительный результат на T . Инфекция fetus имела значительно большее количество представителей рода Megamonas и Helicobacter по сравнению с кошками, которые дали отрицательный результат на T . Инфекция плода (рис. 3).

Рис. 3. Процентное содержание Megamonas и Helicobacter в фекалиях кошек с ПЦР-отрицательным (n = 72 кошки) или ПЦР-положительным (n = 17 кошек) встречающимся в природе T . плод инфекция.

Точки данных представляют отдельных кошек. Столбцы представляют медиану и межквартильный диапазон. Критерий суммы рангов Манна-Уитни *** p = 0,001 (с поправкой на BH p = 0,043). ** p = 0,003 (с поправкой на BH p = 0,06). BH = Бенджамини-Хохберг.

https://doi.org/10.1371/journal.pone.0246957.g003

Положительный результат теста кошек на T . fetus инфекции в 10,8 раз чаще имели Megamonas (95% ДИ = 1,356 до 85.9, p = 0,016, критерий хи-квадрат) и в 7,9 раза более вероятно присутствие Helicobacter в микробном сообществе (95% ДИ = 1,689–37,210, p = 0,007, критерий хи-квадрат) по сравнению с кошками, у которых отрицательный результат теста на Т . плод инфекция.

Метод сбора образцов фекалий существенно влияет на количество выбранных таксонов в фекалиях кошек, протестированных на

T . плод инфекция

При изучении влияния доступных метаданных на кошек, проходящих тестирование на T . fetus , существенных различий в альфа- или бета-разнообразии в зависимости от стадии жизни, породы, пола, метода сбора образцов фекалий, клинических признаков диареи или истории лечения не наблюдалось. Однако метод сбора образцов фекалий оказал значительное влияние на относительную численность представителей рода Prevotella и Campylobacter (рис. 4).

Рис. 4. Процентное содержание Campylobacter и Prevotella в фекалиях кошек, у которых образец был собран после мочеиспускания (n = 41 кошка), с использованием фекальной петли (n = 20 кошек) или с помощью смыва толстой кишки (n = 25 кошек).

Точки данных представляют отдельных кошек. Столбцы представляют медиану и межквартильный диапазон. Односторонний дисперсионный анализ Крускала-Уоллиса по рангам **p<0,01 (с поправкой на BH p = 0,129). BH = Бенджамини-Хохберг.

https://doi.org/10.1371/journal.pone.0246957.g004

Campylobacter был менее обильным в фекалиях, собранных при смыве толстой кишки, по сравнению с образцами, собранными после мочеиспускания или с использованием фекальной петли. В образцах кала, собранных с помощью петли, обнаружен больший процент содержания Prevotella по сравнению с образцами, собранными после мочеиспускания или смыва толстой кишки.

Кошки с экспериментально индуцированным

T . плод инфекция

После орогастральной инфекции все четыре свободных от специфических патогенов котенка были подтверждены положительными на T . плод с помощью ПЦР-анализа фекальной ДНК как через 2 недели, так и через 9 недель после заражения. Ни у одного из котят не было клинических признаков диареи в любой момент времени после заражения.

Анализ последовательностей дал 1 408 793 качественных последовательностей для 12 проанализированных образцов фекалий (среднее значение ± стандартное отклонение = 117 399 ± 26 660).Среди показателей альфа-разнообразия значительные различия наблюдались между образцами фекалий до и после заражения в равномерности обилия видов (альфа-разнообразие Шеннона; Краскела-Уоллиса q = 0,04), но не в количестве различных наблюдаемых таксонов.

Взвешенные измерения бета-разнообразия выявили значительные различия в филогенетическом составе фекальной микробиоты между образцами до и после заражения кошек с экспериментально индуцированным T . плод инфекция (PERMANOVA, q < 0.01) (рис. 5).

Рис. 5. Бета-разнообразие микробиоты Брея-Кертиса у 4 котят до (ПЦР-отрицательный) и в 2 временных точках после (ПЦР-положительный) экспериментального заражения кошачьим T . плод .

Панель A: График анализа основных координат, показывающий скопление микробных сообществ из фекалий кошек до (красные кружки) и после (синие кружки) эксперимента T . плод инфекция. ось 1, 35,52%; ось 2, 26,15%; Ось 3, 14.78%. Панель B: взвешенные Unifrac расстояния между микробными сообществами из фекалий кошек до (ПЦР-отрицательный) и после (ПЦР-положительный) эксперимента T . плод инфекция. Брей-Кертис ПЕРМАНОВА q = 0,003.

https://doi.org/10.1371/journal.pone.0246957.g005

Экспериментальное заражение

T . плод меняет обилие определенных таксонов в фекальном микробиоме кошек

Изобилие специфических таксонов, наблюдаемое в фекалиях котят до и в двух временных точках после экспериментального заражения T . плода показаны в таблице 3.

После учета влияния многочисленных статистических сравнений четыре таксона были идентифицированы как сильно затронутые введением T . плод инфекция. После экспериментального заражения T . fetus фекальная микробиота котят имела значительно более низкую численность представителей рода Dialister и Megamonas и значительно большую численность представителей класса Betaproteobacteria и семейства Succinivibrionaceae по сравнению с котятами до появления котят (рис. 6 и 7).

Рис. 6. Дифференциально распространенные микробные таксоны, выявленные с помощью Анализа состава микробиомов (ANCOM).

График дифференциальной численности вулкана, сравнивающий котят до и после экспериментального заражения T . плод . Clr (ось x) — это мера разницы в величине эффекта для конкретного вида между двумя условиями. W-статистика (ось Y) представляет собой силу теста ANCOM для тестируемого количества видов.

https://дои.org/10.1371/journal.pone.0246957.g006

Рис. 7. Процентная численность Dialister , Megamonas , Betaproteobacteria и Succinivibrionaceae в после (2 недели и 9 недель) экспериментального заражения кошачьим T . плод .

Точки данных представляют отдельных кошек. Столбцы представляют медиану и межквартильный диапазон. **p<0,01 (с поправкой на Бенджамини-Хохберга p<0.15).

https://doi.org/10.1371/journal.pone.0246957.g007

Обсуждение

Чтобы лучше понять роль микробиоты толстой кишки в патогенезе T . fetus инфекции у кошек, мы охарактеризовали фекальную микробиоту 89 кошек, прошедших тестирование на естественную инфекцию. Каждый образец фекалий был отправлен на диагностику T . плод ПЦР-тестирование на основании клинических признаков, таких как диарея, воздействие в анамнезе или в целях скрининга инфекции.В целом, у 19% кошек в этой популяции был диагностирован T . плод , в то время как остальные 81% имели любое количество других потенциальных причин своих клинических признаков. На основании секвенирования гена 16S рРНК T . Инфекция fetus не изменила преобладающие бактериальные типы, присутствующие в фекалиях, которые были сходны по идентичности с предыдущими описаниями фекальной микробиоты у кошек [34–38]. Эти типы были представлены в основном Firmicutes, Bacteroidetes, Proteobacteria, Actinobacteria и Fusobacteria.Наличие T . fetus также не влияли на общее количество или разнообразие различных таксонов, присутствующих в микробном сообществе. Однако T . плод оказал значительное влияние на членство в сообществе, что может быть связано с увеличением как присутствия, так и относительной численности рода Megamonas (тип Firmicutes, семейство Veillonellaceae) и Helicobacter (тип Proteobacteria). Ключевым атрибутом этого исследования была наша способность распространить это наблюдение на уровне популяции на оценку специфического воздействия экспериментально введенного T . fetus в группе специально выведенных котят, которые контролировались по возрасту, полу, питанию и фоновому микробиому. У этих котят введение T . fetus привело к уменьшению относительной численности представителей рода Megamonas и Dialister (тип Firmicutes, семейство Veillonellaceae) и значительному увеличению численности представителей класса Betaproteobacteria и семейства Succinivibrionaceae (филум )

Примечательно, что изменения в семействе Viellonellaceae и конкретном роде Megamonas были специфически и значительно затронуты как естественным, так и экспериментально индуцированным T . плод инфекция. И Megamonas , и Dialister продуцируют большое количество короткоцепочечных жирных кислот, таких как пропионат и лактат, которые, как считается, обладают противовоспалительными свойствами и обеспечивают большую часть энергоснабжения колоноцитов [39].Более высокая численность Megamonas в микробном сообществе является отличительной чертой здоровых кошек [40]. Уменьшение этих таксонов наблюдается у котят с экспериментально индуцированным T . fetus , обычно ассоциируется с болезненными состояниями, такими как ВЗК [40–42]. Низкий уровень короткоцепочечных жирных кислот может привести к аутофагии колоноцитов, что может способствовать патогенному действию T . плода или каким-то образом способствовать его выживанию.

Скорее всего T . плод частично способствует дисбактериозу за счет конкуренции за ферментируемые субстраты. У мышей наличие ферментируемой клетчатки является необходимым условием для успешной колонизации кишечника комменсальной трихомонадой Tritrichomonas musculis [43]. Конкретные виды кишечных бактерий также конкурируют за этот источник клетчатки. Исследования показали, что наличие ферментируемой клетчатки может влиять на численность Megamonas и других представителей семейства Veillonellaceae [44–48].Например, у кошек, которых кормили экструдированной диетой на основе цыплят, было больше видов Megamonas по сравнению с теми, которых кормили сырыми целыми цыплятами [45]. Точно так же введение ферментируемых пребиотиков, содержащих фруктоолигосахариды или инулин, приводит к более высокому содержанию Veillonellaceae в фекалиях кошек [46] и, в частности, рода Megamonas у собак [47]. Потребляя доступное волокно, T . плод может косвенно снижать численность Megamonas и Dialister посредством конкуренции за доступные питательные вещества.

Основные продукты брожения товарной позиции T . fetus представляют собой сукцинат, ацетат и молекулярный водород [49]. Сукцинат также является ключевым субстратом или продуктом метаболизма Veillonellaceae ( Megamonas и Dialister ) и Succinovibrionaceae [50]. Сукцинат является важной провоспалительной сигнальной молекулой [50], которая может представлять интерес как медиатор патогенеза заболевания у T . плод инфекция.У мышей колонизация T . musculis повышает концентрацию сукцината в кишечнике, который стимулирует сукцинатные рецепторы пучковых клеток, что приводит к активации иммунного ответа 2-го типа [43, 51]. Активация эпителиальной инфламмасомы хозяина с помощью T . musculis усугубляет развитие Т-клеточного колита [52]. Сукцинат увеличивается в просвете кишечника мышей и людей с воспалительным заболеванием кишечника и коррелирует с активностью заболевания [53].Сообщается об уменьшении бактериальных штаммов, потребляющих сукцинат, у людей с ВЗК [54]. Соответственно, стоит учитывать, что продукты метаболизма T . плод или дисбиотическая микробиота способствуют патогенезу воспаления толстой кишки и диареи у кошек с T . плод инфекция. Если это так, то на T могут повлиять манипуляции с субстратами для ферментации пищи, добавление конкурирующих пробиотиков или введение отдельных метаболитов. плод выживаемость, вторичный микробный дисбиоз или патогенные воздействия.

В отличие от экспериментально инфицированных котят, у кошек, встречающихся в природе T . Инфекция fetus привела к значительному увеличению количества Megamonas , а также Helicobacter . Это интересное открытие, так как недавнее исследование, сравнивающее микробиом здоровых кошек с теми, у кого хроническая и острая диарея, выявило значительное увеличение Helicobacter и Megamonas у нормальных кошек по сравнению с кошками с диареей [40].Это открытие у наших естественно инфицированных кошек может указывать на разрешение дисбиоза с более хроническим T . Инфекция плода по сравнению с острыми стадиями экспериментальной инфекции. Другие объяснения могут включать использование одного штамма T . плод для экспериментальной инфекции, которая привела к уникальному эффекту, различиям в возрасте между двумя популяциями кошек, лежащим в основе различиям в экологии микробиома между специально выведенными котятами и беспородной популяцией кошек или использованию различных методов выделения ДНК для естественно инфицированных кошек по сравнению сэкспериментально инфицированных котят. Также возможно, что кошки с более высоким содержанием Megamonas или Helicobacter более восприимчивы к заражению T . плод через изменения в микроокружении толстой кишки. Аналогичное явление было описано у женщин, у которых изменения количества и специфичности вагинальных видов Lactobacillus связаны с повышенным риском развития T . vaginalis инфекции [22].

Беспородной популяции кошек, включенных в это исследование, присущи многочисленные переменные, потенциально влияющие на микробиоту, включая различия в возрасте, породе, поле, клинических признаках диареи и проводимом лечении [34, 37, 40, 55, 56]. Дополнительные факторы, которые были неизвестны для этих кошек, включают различия в диете, окружающей среде, сопутствующие заболевания или сопутствующие инфекции [35, 36, 38, 56–58]. Хотя эти переменные продемонстрировали влияние на фекальную микробиоту в исследованиях, контролирующих их эффекты, их влияние в этой большой группе перекрестных исследований не оказалось значительным.Однако мы наблюдали значительное влияние метода сбора фекалий на состав микробиома. Эти результаты, вероятно, отражают предпочтительный отбор проб микробиоты из разных микробных ниш. В настоящем исследовании Prevotella наблюдалась в большем количестве в образцах фекалий, собранных петлей, чем другими методами. У людей Prevotella является преобладающим таксоном в прямой кишке, где он наблюдается в большем количестве в образцах слизистой оболочки прямой кишки по сравнению с фекалиями [59].Образцы, собранные петлей, с большей вероятностью разрушали микробиоту поверхности слизистой оболочки, тем самым увеличивая извлечение Prevotella . Значительно более низкая численность Campylobacter наблюдалась в образцах, собранных методом промывки в нашем исследовании. У свиней Campylobacter значительно больше в слизистой оболочке, чем в содержимом просвета [60]. Соответственно, образцы, собранные смывом, с большей вероятностью захватывают бактерии, не связанные со слизистой оболочкой. Эти наблюдения подчеркивают как влияние метода сбора образцов на результаты анализа микробиома, так и подтверждают способность нашего исследования обнаруживать ожидаемые различия между этими методами.Всем кошкам в исследовании была предоставлена ​​​​анамнез лечения, и те, которые сообщили об использовании противомикробных препаратов, были исключены. Сообщений о других видах лечения было слишком мало, чтобы можно было надежно изучить влияние лечения на состав микробиоты.

В этом первом исследовании фекальной микробиоты у кошек с и без T . fetus , специфические изменения численности представителей Veillonellaceae и Succinivibrionaceae предполагают изменение ферментативного метаболизма в толстой кишке кошек с T . плод инфекция. Эти результаты подтверждают дополнительные исследования состава и функционального воздействия фекального метаболизма на воспаление толстой кишки и диарею у кошек с T . плод инфекция.

Благодарности

Авторы благодарят доктора Бенджамина Каллахана за его вклад в это исследование.

Каталожные номера

  1. 1. Гукин Дж.Л., Брайтшвердт Э.Б., Леви М.Г., Гагер Р.Б., Бенруд Дж.Г. Диарея, связанная с трихомонозом у кошек.Журнал Американской ветеринарной медицинской ассоциации. 1999;215(10):1450–4. пмид:10579040.
  2. 2. Ягер М.Дж., Гукин Дж.Л. Гистологические особенности, связанные с колитом, вызванным Tritricchomonas foetus, у домашних кошек. Ветеринарная патология. 2005;42(6):797–804. пмид: 16301576.
  3. 3. Гукин Дж.Л., Стеббинс М.Е., Хант Э., Бурлоне К., Фултон М., Хохель Р. и соавт. Распространенность и факторы риска инфекции Tritricchomonas fetus и Giardia у кошек. Журнал клинической микробиологии.2004;42(6):2707–10. пмид: 15184456.
  4. 4. Ганн-Мур Д.А., Макканн Т.М., Рид Н., Симпсон К.Е., Теннант Б. Распространенность тритрихомонадной инфекции плода у кошек с диареей в Великобритании. Журнал кошачьей медицины и хирургии. 2007;9(3):214–8. пмид: 17446107.
  5. 5. Гукин Д.Л., Ханрахан К., Леви М.Г. Загадка кошачьего трихомониза. Журнал кошачьей медицины и хирургии. 2017;19(3):261–74. пмид: 28245739.
  6. 6. Яо С, Костер ЛС. Тритрихомонадная инфекция плода, причина хронической диареи у домашней кошки.Вет рез. 2015;46:35. пмид: 25880025; Центральный PMCID в PubMed: PMC4364588.
  7. 7. Гукин Д.Л., Штауффер С.Х., Дайбас Д., Кэннон Д.Х. Документация об аэробной резистентности in vivo и in vitro кошачьих изолятов Tritrichomonas fetus к ронидазолу. Журнал ветеринарной медицины внутренних органов. 2010;24(4):1003–7. пмид:20492492.
  8. 8. Кэтер Э.Дж., Маркс С.Л., Касс П.Х. Определение in vitro чувствительности плода тритрихомонады кошек к 5 противомикробным препаратам. Журнал ветеринарной медицины внутренних органов.2007;21(5):966–70. пмид: 17939550.
  9. 9. Фостер Д.М., Гукин Дж.Л., Пур М.Ф., Стеббинс М.Е., Леви М.Г. Исход кошек с диареей и тритрихомонадной инфекцией плода. Журнал Американской ветеринарной медицинской ассоциации. 2004;225(6):888–92. пмид: 15485048.
  10. 10. Фигероа-Ангуло Э.Э., Рендон-Гандарилья Ф.Дж., Пуэнте-Ривера Дж., Калла-Чоке Дж.С., Карденас-Гуэрра Р.Е., Ортега-Лопес Дж. и др. Влияние факторов окружающей среды на вирулентность Trichomonas vaginalis.микробы заражают. 2012;14(15):1411–27. пмид: 23022315.
  11. 11. Толберт М.К., Гукин Дж.Л. Механизмы патогенности Tritrichomonas fetus у кошек с инсайтами о венерическом трихомонозе. Журнал ветеринарной медицины внутренних органов. 2016;30(2):516–26. пмид: 26946069; Центральный PMCID в PubMed: PMC4913604.
  12. 12. да Коста РФ, де Соуза В., Бенчимол М., Альдерете Дж.Ф., Моргадо-Диас Дж.А. Trichomonas vaginalis нарушает соединительный комплекс в эпителиальных клетках. Клеточные исследования.2005;15(9):704–16. пмид: 16212877.
  13. 13. Сингх Б.Н., Лукас Дж.Дж., Хейс Г.Р., Кумар И., Бич Д.Х., Фрайблат М. и др. Tritrichomonas fetus индуцирует апоптозную гибель клеток вагинального эпителия крупного рогатого скота. Заразить иммун. 2004;72(7):4151–8. пмид: 15213160.
  14. 14. Соммер У., Костелло К.Е., Хейс Г.Р., Бич Д.Х., Гилберт Р.О., Лукас Дж.Дж. и др. Идентификация цистеиновых протеаз Trichomonas vaginalis, которые индуцируют апоптоз в эпителиальных клетках влагалища человека. Журнал биологической химии.2005;280(25):23853–60. пмид: 15843376.
  15. 15. Ан М.Х., Сонг Х.О., Рю Дж.С. Индуцированный Trichomonas vaginalis апоптоз нейтрофилов вызывает выработку противовоспалительных цитокинов макрофагами, происходящими из моноцитов человека. Иммунол от паразитов. 2008;30(8):410–6. пмид: 18492033.
  16. 16. Чанг Дж. Х., Рян Ю. С., Морио Т., Ли С. К., Чанг Э. Д. Trichomonas vaginalis ингибирует продукцию провоспалительных цитокинов в макрофагах, подавляя активацию NF-kappaB. Мол клетки. 2004;18(2):177–85.пмид: 15528993.
  17. 17. Гукин Дж.Л., Леви М.Г., Лоу Дж.М., Папич М.Г., Пур М.Ф., Брайтшвердт Э.Б. Экспериментальное заражение кошек Tritrichomonas foetus. Американский журнал ветеринарных исследований. 2001;62(11):1690–7. пмид:11703009.
  18. 18. Гукин Дж.Л., Стоун М.Р., Яегер М.Дж., Мейерхольц Д.К., Мойсан П. Флуоресцентная гибридизация in situ для идентификации плода Tritrichomonas в фиксированных формалином и залитых парафином гистологических образцах кишечного трихомониаза.Вет Паразитол. 2010; 172(1–2):139–43. пмид: 20447769.
  19. 19. Бротман Р.М., Брэдфорд Л.Л., Конрад М., Гаджер П., Олт К., Перальта Л. и др. Связь между Trichomonas vaginalis и составом бактериального сообщества влагалища у женщин репродуктивного возраста. Заболевания, передающиеся половым путем. 2012;39(10):807–12. пмид: 23007708; Центральный PMCID в PubMed: PMC3458234.
  20. 20. Хиндерфельд А.С., Фукан Н., Бар А.К., Робертон А.М., Симоес-Барбоза А. Совместные взаимодействия между Trichomonas vaginalis и ассоциированными бактериями повышают парацеллюлярную проницаемость цервиковагинального эпителия за счет нарушения регуляции плотных соединений.Заразить иммун. 2019;87(5). пмид:30858343; Центральный PMCID в PubMed: PMC6479042.
  21. 21. Хиндерфельд А.С., Симоэс-Барбоза А. Вагинальные дисбиотические бактерии выступают в роли патобионтов протозойного возбудителя Trichomonas vaginalis. Микробный патогенез. 2020;138:103820. пмид:31669328.
  22. 22. Джарретт О.Д., Шринивасан С., Ричардсон Б.А., Фидлер Т., Уоллис Дж.М., Кинутия Дж. и соавт. Определенные вагинальные бактерии связаны с повышенным риском заражения Trichomonas vaginalis у женщин.Журнал инфекционных болезней. 2019; 220(9):1503–10. пмид:31287879; Центральный PMCID в PubMed: PMC6761949.
  23. 23. Wei Y, Gao J, Kou Y, Meng L, Zheng X, Liang M, et al. Комменсальные бактерии влияют на интеграцию простейших в микробиоту кишечника мышей в зависимости от пищевых питательных веществ. Прикладная и экологическая микробиология. 2020;86(11). пмид:32198171; Центральный PMCID в PubMed: PMC7237772.
  24. 24. Midlej V, Benchimol M. Trichomonas vaginalis убивает и поедает — свидетельство фагоцитарной активности как цитопатического эффекта.Паразитология. 2010;137(1):65–76. пмид: 19723359.
  25. 25. Штауффер С.Х., Биркенхойер А.Дж., Леви М.Г., Марр Х., Гукин Д.Л. Оценка четырех методов выделения ДНК для обнаружения Tritrichomonas fetus в образцах стула кошек с помощью полимеразной цепной реакции. Журнал ветеринарных диагностических исследований: официальная публикация Американской ассоциации ветеринарных лабораторных диагностов, Inc. 2008;20(5):639–41. пмид: 18776100.
  26. 26. Хеджеспет Б.А., Штауффер С.Х., Робертсон Д.Б., Гукин Д.Л.Ассоциация метода сбора образцов фекалий и истории лечения с результатами теста полимеразной цепной реакции Tritrichomonas fetus у 1717 кошек. Журнал ветеринарной медицины внутренних органов. 2020;34(2):734–41. пмид:32039505; Центральный PMCID в PubMed: PMC7096610.
  27. 27. Vogt AH, Rodan I, Brown M, Brown S, Buffington CA, Forman MJ, et al. AAFP-AAHA: рекомендации по этапам жизни кошек. J Am Anim Hosp Assoc. 2010;46(1):70–85. пмид: 20045841.
  28. 28. Гукин Д.Л., Штауффер С.Х., Коккаро М.Р., Пур М.Ф., Леви М.Г., Папич М.Г.Эффективность тинидазола для лечения кошек, экспериментально инфицированных Tritrichomonas foetus. Американский журнал ветеринарных исследований. 2007;68(10):1085–8. пмид: 17916015.
  29. 29. Гукин Д.Л., Биркенхойер А.Дж., Брайтшвердт Э.Б., Леви М.Г. Гнездовая ПЦР в одной пробирке для обнаружения плода тритрихомонады в кошачьих фекалиях. Журнал клинической микробиологии. 2002;40(11):4126–30. пмид:12409385.
  30. 30. Caporaso JG, Lauber CL, Walters WA, Berg-Lyons D, Lozupone CA, Turnbaugh PJ, et al.Глобальные закономерности разнообразия 16S рРНК на глубине миллионов последовательностей на образец. Труды Национальной академии наук Соединенных Штатов Америки. 2011; 108 Приложение 1:4516–22. Эпублик 11.06.2010. пмид: 20534432; Центральный PMCID в PubMed: PMC3063599.
  31. 31. Bolyen E, Rideout JR, Dillon MR, Bokulich NA, Abnet CC, Al-Ghalith GA, et al. Воспроизводимая, интерактивная, масштабируемая и расширяемая наука о микробиомах с использованием QIIME 2. Природная биотехнология. 2019;37(8):852–7. Эпаб 2019/07/26.пмид:31341288; Центральный PMCID в PubMed: PMC7015180.
  32. 32. Бургон Р., Джентльмен Р., Хубер В. Независимая фильтрация увеличивает мощность обнаружения для высокопроизводительных экспериментов. Труды Национальной академии наук Соединенных Штатов Америки. 2010;107(21):9546–51. пмид: 20460310; Центральный PMCID в PubMed: PMC2

    5.
  33. 33. Бенджамини Ю., Хохберг Ю. Контроль уровня ложных открытий: практичный и мощный подход к множественному тестированию. Журнал Королевского статистического общества, серия B (методологический).1995;57(1):289–300.
  34. 34. Гарсия-Маскорро Дж.Ф., Ланери Д.Дж., Дауд С.Е., Паддок К.Г., Грутцнер Н., Штайнер Дж.М. и др. Влияние многовидовой синбиотической композиции на фекальную бактериальную микробиоту здоровых кошек и собак, оцененное с помощью пиросеквенирования. FEMS микробиология экология. 2011;78(3):542–54. пмид: 22067056.
  35. 35. Худа С., Вестер Болер Б.М., Керр К.Р., Дауд С.Е., Суонсон К.С. Микробиом кишечника котят зависит от соотношения белков и углеводов в рационе и связан с концентрацией метаболитов в крови и гормонов.Британский журнал о питании. 2013;109(9):1637–46. пмид: 22935193.
  36. 36. Джиа Дж., Франц Н., Кху К., Гибсон Г.Р., Растолл Р.А., Маккартни А.Л. Исследование фекальной микробиоты котят: мониторинг бактериальной последовательности и влияние диеты. FEMS микробиология экология. 2011;78(2):395–404. пмид: 22092177.
  37. 37. Деуш О., О’Флинн С., Кольер А., Суонсон К.С., Аллавей Д., Моррис П. Продольное исследование фекального микробиома кошек выявляет изменения в раннем взрослом возрасте независимо от полового развития.ПлоС один. 2015;10(12):e0144881. пмид: 26659594; Центральный PMCID в PubMed: PMC4682054.
  38. 38. Bermingham EN, Young W, Kittelmann S, Kerr KR, Swanson KS, Roy NC, et al. Диетический формат изменяет популяцию фекальных бактерий у домашней кошки (Felis catus). МикробиологияОткрыть. 2013;2(1):173–81. пмид: 23297252; Центральный PMCID в PubMed: PMC3584222.
  39. 39. Редигер ВЭ. Утилизация питательных веществ изолированными эпителиальными клетками толстой кишки крысы. Гастроэнтерология. 1982;83(2):424–9.пмид:7084619.
  40. 40. Суходольский Дж.С., Фостер М.Л., Сохаил М.Ю., Лойтенеггер С., Королева Э.В., Штайнер Дж.М. и соавт. Фекальный микробиом у кошек с диареей. ПлоС один. 2015;10(5):e0127378. пмид: 25992741; Центральный PMCID в PubMed: PMC4437779.
  41. 41. Суходольский Дж.С., Дауд С.Е., Вилке В., Штайнер Дж.М., Джергенс А.Е. Пиросеквенирование гена 16S рРНК выявляет бактериальный дисбактериоз в двенадцатиперстной кишке собак с идиопатическим воспалительным заболеванием кишечника. ПлоС один. 2012;7(6):e39333. пмид: 22720094; Центральный PMCID в PubMed: PMC3376104.
  42. 42. Minamoto Y, Otoni CC, Steelman SM, Buyukleblebici O, Steiner JM, Jergens AE, et al. Изменение профилей фекальной микробиоты и метаболитов сыворотки у собак с идиопатическим воспалительным заболеванием кишечника. Кишечные микробы. 2015;6(1):33–47. пмид: 25531678; Центральный PMCID в PubMed: PMC4615558.
  43. 43. Шнайдер С., О’Лири К.Э., фон Мольтке Дж., Лян Х.Е., Анг К.Ю., Тернбо П.Дж. и др. Цепь Tuft Cell-ILC2, запускаемая метаболитами, стимулирует ремоделирование тонкой кишки.Клетка. 2018;174(2):271–84 e14. пмид: 29887373; Центральный PMCID в PubMed: PMC6046262.
  44. 44. Сандри М., Дал Монего С., Конте Г., Сгорлон С., Стефанон Б. Диета на основе сырого мяса влияет на фекальный микробиом и конечные продукты ферментации у здоровых собак. Ветеринарные исследования BMC. 2017;13(1):65. пмид: 28245817; Центральный PMCID в PubMed: PMC5331737.
  45. 45. Керр К.Р., Дауд С.Е., Суонсон К.С. Фекальная микробиота домашних кошек, которых кормили сырыми целыми цыплятами по сравнению с экструдированным рационом на основе курицы.Журнал диетологии. 2014;3:e22. пмид: 26101591; Центральный PMCID в PubMed: PMC4473156.
  46. 46. Гарсия-Маскорро Дж. Ф., Барсенас-Уоллс Дж. Р., Суходольский Дж. С., Штайнер Дж. М. Молекулярная оценка фекальной микробиоты у здоровых кошек и собак до и во время приема фруктоолигосахаридов (ФОС) и инулина с использованием высокопроизводительного 454-пиросеквенирования. Пир Дж. 2017;5:e3184. пмид: 28439463; Центральный PMCID в PubMed: PMC5398277.
  47. 47. Белошапка А.Н., Дауд С.Е., Суходольский Дж.С., Штайнер Дж.М., Дюкло Л., Суонсон К.С.Фекальные микробные сообщества здоровых взрослых собак, получавших диеты на основе сырого мяса с или без инулина или экстрактов клеточных стенок дрожжей, по оценке 454 пиросеквенирования. FEMS микробиология экология. 2013;84(3):532–41. пмид: 23360519.
  48. 48. Джексон М.И., Джуэлл Д.Е. Баланс сахаролиза и протеолиза лежит в основе улучшения качества стула, вызванного добавлением пучка волокон, содержащего связанные полифенолы, либо к гидролизованному мясу, либо к продуктам, богатым зерном. Кишечные микробы. 2019;10(3):298–320. пмид:30376392; Центральный PMCID в PubMed: PMC6546335.
  49. 49. Линдмарк Д.Г., Экенроде Б.Л., Халберг Л.А., Динбергс И.Д. Углеводный, энергетический и гидрогеносомный обмен Tritrichomonas fetus и Trichomonas vaginalis. J Протозол. 1989;36(2):214–6. пмид: 2657037.
  50. 50. Фернандес-Веледо С., Вендрелл Дж. Сукцинат, полученный из микробиоты кишечника: друг или враг в метаболических заболеваниях человека? Обзоры эндокринных и метаболических нарушений. 2019;20(4):439–47. пмид:31654259; Центральный PMCID в PubMed: PMC6938788.
  51. 51.Nadjsombati MS, McGinty JW, Lyons-Cohen MR, Jaffe JB, DiPeso L, Schneider C, et al. Обнаружение сукцината клетками пучка кишечника запускает врожденный иммунный контур 2 типа. Иммунитет. 2018;49(1):33–41 e7. пмид:30021144; Центральный PMCID в PubMed: PMC6084797.
  52. 52. Чудновский А., Морта А., Кана В., Кеннард А., Рамирес Дж. Д., Рахман А. и др. Взаимодействия между хозяином и простейшими Защищают от инфекций слизистых оболочек за счет активации инфламмасомы. Клетка. 2016;167(2):444–56 e14. пмид: 27716507; Центральный PMCID в PubMed: PMC5129837.
  53. 53. Масиас-Сеха Д.С., Ортис-Масиа Д., Сальвадор П., Гисберт-Феррандис Л., Эрнандес С., Хаусманн М. и др. Сукцинатный рецептор опосредует воспаление и фиброз кишечника. Иммунол слизистых оболочек. 2019;12(1):178–87. пмид:30279517.
  54. 54. Morgan XC, Tickle TL, Sokol H, Gevers D, Devaney KL, Ward DV, et al. Дисфункция кишечного микробиома при воспалительных заболеваниях кишечника и лечении. Биология генома. 2012;13(9):R79. пмид: 23013615; Центральный PMCID в PubMed: PMC3506950.
  55. 55. Джиа Дж., Франц Н., Кху К., Гибсон Г.Р., Растолл Р.А., Маккартни А.Л. Исследование фекальной микробиоты пожилых кошек. Письма в прикладную микробиологию. 2011;53(3):288–93. пмид: 21699553.
  56. 56. Bermingham EN, Young W, Butowski CF, Moon CD, Maclean PH, Rosendale D, et al. На фекальную микробиоту домашней кошки (Felis catus) влияет взаимодействие между возрастом и рационом питания; Пятилетнее лонгитюдное исследование. Фронт микробиол. 2018;9:1231. пмид: 29971046; Центральный PMCID в PubMed: PMC6018416.
  57. 57. Марсилио С., Пилла Р., Саравичитр Б., Чоу Б., Хилл С.Л., Акерманн М.Р. и др. Характеристика фекального микробиома у кошек с воспалительным заболеванием кишечника или алиментарной мелкоклеточной лимфомой. Научный доклад 2019;9(1):19208. пмид:31844119; Центральный PMCID в PubMed: PMC6914782.
  58. 58. Young W, Moon CD, Thomas DG, Cave NJ, Bermingham EN. Диета до и после отъема изменяет метагеном фекалий у кошек с различиями в изобилии генов метаболизма витаминов и углеводов.Научный доклад 2016; 6: 34668. пмид: 27876765; Центральный PMCID в PubMed: PMC5120286.
  59. 59. Ли Г, Ян М, Чжоу К, Чжан Л, Тянь Л, Лв С и др. Разнообразие дуоденальной и ректальной микробиоты в биопсийных тканях и люминальном содержимом у здоровых добровольцев. Журнал микробиологии и биотехнологии. 2015;25(7):1136–45. пмид: 25737115.
  60. 60. Адхикари Б., Ким С.В., Квон Ю.М. Характеристика микробиоты, связанной с пищеварением и слизистой оболочкой различных отделов желудочно-кишечного тракта поросят-поросят.Международный журнал молекулярных наук. 2019;20(7). пмид:30986907; Центральный PMCID в PubMed: PMC6480377.

Лямблиоз у животных — пищеварительная система

  • Устранение клинических признаков по сравнению с прекращением выделения кисты одобрен для лечения собак в большинстве стран Европы (хотя в некоторых странах только на 3 дня лечения) и может быть рекомендован для кошек.Сообщается, что он останавливает выделение цист Giardia у собак без побочных эффектов и безопасен для беременных и кормящих животных. Таким образом, фенбендазол считается препаратом первой линии для лечения, но метронидазол можно рассматривать отдельно или вместе с фенбендазолом, если клинические симптомы сохраняются. Однако, хотя сообщалось об успешном лечении собак метронидазолом (25 мг/кг каждые 12 часов или 50 мг/кг в день в течение 5 дней), и он лицензирован в большинстве европейских стран для лечения как собак, так и кошек, это было связано с серьезными побочными эффектами ЦНС у собак после длительного лечения или высоких доз.

    Альбендазол не рекомендуется применять у собак и кошек из-за возможного угнетения функции костного мозга. Также было показано, что комбинация празиквантела (5 мг/кг), пирантела (15 мг/кг) и фебантела (15 мг/кг) один раз в день в течение 3 дней эффективна для лечения собак и лицензирована в большинстве европейских стран, а также за пределами ЕС. Другие агенты также были опробованы экспериментально, особенно когда более обычные схемы лечения оказались безуспешными. К ним относятся, помимо прочего, азитромицин (10 мг/кг в сутки в течение 5 дней), нитазоксанид (75 мг/кг в сутки в течение 14 дней), тинидазол (50 мг/кг в сутки в течение 5 дней) , секнидазол (30 мг/кг, две разовые дозы с интервалом в 2 недели) и хлорохин (2.5 мг/кг каждые 12 часов в течение 5 дней). В целом, опубликованные отчеты о таких исследованиях показывают, что новое лечение оказалось успешным.

    Несмотря на отсутствие лицензированных препаратов для лечения Giardia у домашнего скота, было показано, что как фенбендазол, так и альбендазол (5–20 мг/кг в день в течение 3 дней) уменьшают выделение цист как у овец, так и у крупного рогатого скота и обеспечивают некоторую клиническую пользу (уменьшение диареи и увеличение веса). Также было обнаружено, что паромомицин (50–75 мг/кг в день в течение 5 дней) эффективен у крупного рогатого скота.Другие методы лечения были опробованы на домашнем скоте и показали свою эффективность (например, секнидазол, 10 мг/кг).

Добавить комментарий

Ваш адрес email не будет опубликован.