Содержание

Все, что следует знать о видах, содержании и уходе за пецилиями

Пецилии являются представителями семейства карпозубых. Рыбок-пецилий аквариумисты любят за их ярчайший окрас, возможность разводить в домашних условиях, поскольку они живородящие, и абсолютную неприхотливость. Особой популярностью они пользуются у тех аквариумистов, которые только делают первые шаги.

Чтобы пецилии радовали Вас как можно дольше, а не погибли через пару недель после того, как попали в Ваш аквариум, нужно соблюдать определенные правила. О них и о многом другом мы сейчас расскажем.

Среда природного обитания пецилий

Пецилии или иначе моллинезии родом сЮжно-Американского материка, а именно из Гватемалы и Мексики. Здесь они обитают в стоячих и проточных водоемах разных по размеру, пресноводных и со слегка соленой водой, с гравийным грунтом и обилием водных растений. Встречаются пецилии в устьях рек, впадающих в Атлантический океан, а самыми красивыми экземплярами пецилий славятся реки, текущие по острову Юкатан.

Природные особи с желтовато-коричневым окрасом с черными пятнами легко отличимы от тех, которые получены путем искусственного выведения – они яркие и разноцветные. В европейские аквариумы они впервые попали в начале прошлого века, а в российские – спустя полвека. Пецилии являются очень привлекательным материалом для селекционеров, которые выводят все новые и новые их разновидности. Именно своему многообразию пецилии сегодня столь популярны во всем мире. Многообразны они не только по окрасу (свыше 130 вариантов), но и по форме.

Строение и размеры пецилий

Рыбка имеет туловище ромбовидной формы, удлиненное и высокое, со сжатыми боками и плавниками округлого очертания и небольшой головой с довольно большими глазами т чуть вздернутым ртом. Есть виды пецилий с формой туловища в виде редиса. Они получены в результате скрещивания с рыбками с укороченным хребтом.

Размер самок больше, чем самцов (7 см против 5,5 см), к тому же самки не так изящны как самцы. Мужские особи можно отличить не только по размеру, но и по трем другим внешним признакам: геноподию (анальному плавнику), завернутому в трубочку, отсутствию на хвосте меча и как бы разделенному на две половинки окрасу ( примерно, как у породы собак бобтейл). Одна половинка характеризуется преобладанием желтого цвета, вторая голубого.

Удачное соседство для пецилий

Дружелюбие этого вида рыбок позволяет им легко уживаться с остальным населением аквариума. Однако наиболее целесообразными соседями станут для пецилий такие спокойные, со сдержанным темпераментом и лишенные агрессии виды рыб, как они сами. К ним относятся гуппи, меченосцы, склярии, гурами и проч. Не стоит поселять пецилий в аквариум, где уже живут хищники (карпы, цихлиды, золотые рыбки и т.п.).

Целесообразно содержать в одном аквариуме и самок, и самцов. Дело в том, что в период между 8 месяцами и годом самцы приобретают половозрелость, а самки уже через полгода. Достигшие полового созревания особи начинают активно спариваться, так что уже через месяц можно ждать потомство. Как создать оптимальные условия обитания для пецилий

Хотя моллинезии совершенно не притязательны, это вовсе не означает, что они могут жить в любых условиях.

Начнем с подбора размера аквариума. Поскольку рыбки любят плавать в средних толщах воды, то аквариум для них нужен небольшой по объему, а в меру глубокий. Минимальная для них емкость 10-литровая, но самая комфортная – 50-литровая, в которой у них будет полный простор. Крышка на аквариуме – обязательна, так как она не дает пецилиям случайно выпрыгнуть из воды во время игры.

Качество воды в аквариуме. Уровень рН воды должна находиться в пределах 7,5-8 единиц, dH (показатель жесткости) должен быть в диапазоне 8-25, а средняя температура примерно не должна быть ниже 22 град. и выше 26 град. Поддержание всех этих параметров воды способствует хорошему здоровью пецилий и высокой продолжительности жизни. Не советуем подсаливать воду, как эо делают некоторые владельцы аквариумов с пецилиями. Соль применяется как лекарство для лечения больных и слабых особей. Если вода будет соленой постоянно, то рыбки со временем утратят иммунитет и будут восприимчивы к заболеваниям.

Фильтрация и аэрация воды. В принципе, особых требований к ним нет. Вполне достаточно менять 25% воды на свежую еженедельно. Однако ни от установка фильтра, ни от установки аэратора хуже не будет.

Освещение. Для маленьких по объему аквариумов достаточно солнечного света, но не прямых лучей, или маломощной лампы, если он стоит в темном месте.

Требования к растениям. Высадите в задней части емкости грунтовые растения, которым не нужны специфические условия содержания, для создания подводных зарослей. Пецилии будут в них прятаться. Переднюю часть аквариума лучше оставить без растений.

Чем болеют пецилии

Угрозу здоровью этому виду рыбок представляют:

  1. разнообразные бактерии, попадающие в воду с пищей или при подмене воды,
  2. слишком низкая температура воды в аквариуме.

Самое распространенное заболевание у пецилий – плавниковая гниль. Ее вызывает инфекция, а проявляется она появлением на теле рыбок белых точек, пузырьков, грибковым налетом. Чтобы остановить распространение болезни больную рыбку нужно пересадить в отдельную емкость, воду подсолить из расчета 10 г соли/л и поднять температуру воды. Готовое лечебное средство в виде раствора можно купить в ветаптеке.

Поделиться в соц. сетях:

Пецилия: Содержание И Уход — Семейство рыб «Пецилиевые, или гамбузиевые (Poeciliidae)»

Как и все живородящие пецилия, неприхотлива, вынослива и необычайно плодовита. Именно эти качества привлекают в ней начинающих аквариумистов. Хотя, и опытные не брезгуют ею при запуске новой «банки». Поговорим, в таком случае, о ней немного подробнее и мы.
Эти живородящие карпозубые своей родиной обязаны Южной Америке: Мексике и Гватемале. Реки, речушки, даже застойные лужи с грязью, гравием и различной растительностью хорошо прогреваются и содержат всевозможную органику, что и определило их природные особенности обитания.
Условия, которые уже более ста лет поддерживаются содержащими их любителями по всему миру такие:
1. Температурный режим. Нижний, комфортный предел — 18С°, оптимальный – 22-25С°.
2. Неприхотливая всеядность.
3. Необычайная плодовитость. Описаны случаи, когда самка выметывала до 140 мальков, средняя же – 50-80 мелких, но вполне жизнеспособных рыбешек, жмущихся в стайку и прячущихся в плавающей у поверхности растительности.
4. Аэрация аквариума не обязательна. Но при этом крайне желательны простые, неприхотливые растения у задней стенки аквариума (элодея, роголистник, анубы) и свободное пространство у переднего стекла.
Природные пецилии, Platypoecilus maculata, размером короче и шире своего ближайшего родственника – меченосца (кстати, этимология слова пецилия – от греческого Poeciliidae, носитель меча). Самки от кончика рта до основания хвоста – 5-6см, самцы поскромнее – 2-3см. Окрас светло-желтый с более темными, оливково-коричневыми вкраплениями и темным пятном в районе предхвостья.
Относительно небольшой срок жизни живородящих и суровые условия выживания молодняка наделили их необычайным стремлением к выживанию. Стремлением, выразившимся в способности скрещиваться между собой. Курьезен, но показателен тот факт, что природных меченосцев красного цвета не существует, но это не мешает им преспокойно жить в аквариумах тысяч и тысяч аквариумистов. Гибрид был получен посредством скрещивания с пецилией красной. Так же и с классификацией искусственно выведенных Пецилий. Род насчитывает, ни много, ни мало, 33 описанных вида и массу гибридных форм:

Содержание пецилий
Из оборудования аквариума, в который вы планируете запустить этих неприхотливых и, по сути, миролюбивых рыбок, самыми необходимыми будут обогреватель и покровное стекло. Температурный режим важен для профилактики заболеваний. А стекло предохранит от выпрыгивания. Объем воды не столь существенен, взрослая пара вполне нормально может жить и размножаться даже в 3-5-ти литровой «банке».
Растения. Очень желательны, особенно для мальков, если вы не планируете отсаживать самку в период родов. И свободное место для игр, для роста. Хотя, все-таки 50-ти литровый аквариум предпочтительней, рыбки не затянутся, сроки беременности самки будут выдержаны и заболевания пройдут стороной. Ведь золотой принцип аквариумистики – чем больше объем вашей искуственной биосферы, тем она стабильней и менее подвержена срывам.
Кормление пецилий не представляет сложностей, так как они всеядны. Но и тут следует все-таки придерживаться основы основ – кормление желательно разнообразить. Сухари (сухой корм), мотыль, трубочник, дафнии.
Уход прост и незатейлив – подмены воды раз в неделю, 25-30% от общего объема воды. Чистой, отстоянной, ее температура не должна быть ниже температуры в аквариуме, а лучше на 1-2С° выше. И никогда (кроме лечения сложных болезней) не меняйте весь объем. Этим вы подорвете биологический баланс и перезапустите аквариум.
РазмножениеПриносит огромную радость начинающему аквариумисту! Еще бы, первые роды! Размножаются пецилии быстро, часто и охотно. Период беременности самки от 10 дней до двух месяцев, в зависимости от комфортности условий проживания. Период между выметами 28-60 дней. Проблема только одна – кому раздавать выживший подрастающий молодняк. Взрослые родители охотно пожирают своих мальков, не успевших спрятаться, но и этого можно избежать – почаще подкармливайте их живым кормом – трубочником, мотылем, и они оставят молодняк без внимания.

Болезни и лечениеЛучшим лекарством будет профилактика, т.е. комфортные условия содержания. Основные причины заболеваний – простуда и занесенная с кормом, растениями или подменой воды, инфекция. Но раз уж случилось несчастье…

При появлении на теле рыб пушистых образований их необходимо купать в соляном растворе (около 10 гр соли на литр воды) в течении 10 минут. А затем на 2-3 дня в слабый раствор метиленового синего (синьки). Жаберные инфекции или проблемы с чешуйками – добавляйте трипафлавин и повышайте температуру воды на период карантина до 30С°. Хотя, эти методы не претендуют на истину в последней инстанции, существует масса способов и препаратов фирменного производства. Не будем настаивать, разберетесь самостоятельно. Да и невозможно объять необъятное и описать все в одной статье. Да, кстати, одной из причин заболеваний может быть и неудачное скрещивание.
И напоследок, об одной приметной и забавной особенности пецилий. Самка, даже рожавшая, может отрастить гоноподий (меч на хвостовом плавнике) и сменить пол. Это означает только одно — вы где-то недоглядели и условия содержания рыб в чем-то кардинально поменялись.

содержание и уход :: SYL.ru

Пецилии – это живородящие тепловодные рыбки, которых насчитывается более тридцати тысяч видов.

Они являются самыми известными и любимыми как у начинающих аквариумистов, так и у профессионалов. Центральная и Северная Америка считается их родиной. В дикой природе они предпочитают следующие места обитания:
  • пруды;
  • небольшие водоемы, в том числе и озера;
  • заболоченные низовья рек.

Немного истории

Аквариумисты называют пецилий, принадлежащих к карпозубообразному семейству, моллинезиями. Первоначально так величали только меланисткие формы рыб, а позднее так стали именовать всех пецилий.

Селекция

Селекционерами выведены пецилии, имеющие разную форму тела и плавников. Всего насчитывается больше 130 разных видов этих аквариумных рыб. Из-за большого разнообразия выведенных рыб, похожих по окрасу и форме, имеются трудности определения их видовой принадлежности. Известно около десяти основных цветовых решений окраски пецилий.

Родство с гуппи у всего семейства этих рыбок. Настоящих (истинных) пецилий следует отличать от пецилии пятнистой, которая подразделяется на несколько рас, отличающихся в окрасе. Желтый цвет у основной формы. Цветовая гамма брюшка от белого до желтого, бока зеленовато-синего оттенка. Характерная особенность – темные пятнышки на хвостовом плавнике, отсюда появилось и название. Селекционерами выведено семь типов рыбок, отличающихся расположением пятнышек. При спаривании пецилий пятнистых с другими рыбками без пятен у первого поколения потомства появляются пятнышки, что говорит об их доминантном признаке.

Для получения мальков строго определенного цвета особей содержат в специальном аквариуме или резервуаре. В нерестовик помещают каждую оплодотворенную самочку, где внимательно смотрят за малышами, сортируя их по цветам.

Характеристики

В естественных условиях окрас пецилий желтовато-коричневый. Некоторые рыбки имеют темные пятнышки у хвостового плавника и в целом они не особо привлекательны. Благодаря стараниям селекционеров получены разнообразные расцветки этих замечательных обитателей аквариумов.

При описании пецилий (содержание и уход за которыми рассмотрены ниже) следует отметить плотное, сильное тело и широкий хвостовой плавник. Они очень выносливы и неприхотливы. Самцы почти в два раза меньше и легче самок, имеют гоноподий – орган совокупления. Женские особи достигают в длину шести сантиметров и являются крупными рыбками. Брюшко полное, округлой формы, чешуя блеклого цвета. Анальный плавник широкий, округлый.

Необычна морфология у пецилии дисковой, или пецилии баллон, такое название она получила благодаря искривленному позвоночнику и округлому телу. Этот вид пецилий очень капризный в содержании и уходе.

Разновидности

Несмотря на разнообразие видов пецилий, содержание и уход за ними практически не различаются.

  • Желтая красноплавничная. Цвет тела и спинного плавника желтый, внизу которого заметна кайма белого или черного оттенка. В красный цвет окрашены анальный и спинной плавник.
  • Крапчатая – имеет желтый или красный основной окрас тела с черными крапинками, которые на боках сливаются и образуют широкий так называемый пояс.
  • Берлинская сходна с предыдущей и отличается лишь красным оттенком тела.
  • Голубая – это очень красивая рыбка с телом небесно-голубого цвета, белым брюшком и двумя полосками на хвостовой части. Голова окрашена в желто- или серо-зеленоватый цвет.
  • Кровоточащее сердце – этот вид пецилий обладатели желто-золотистого тела, бело-розового основания плавников, ярко-красного брюшка в передней части. Черные пятнышки, больше похожие на точки, покрывают спинку и спинной плавник.
  • Янтарная или желто-янтарная – это обладатели серо-черных плавников.
  • Желтая. Плавники ярко-лимонного цвета, все тело желтое, без темных вкраплений.
  • Черноплавничная с окрасом тела красного или желтого цвета и чешуйками, обрамленными черной канвой.
  • Альбинос жемчужный с розовой грудкой, головой и передней частью спинки и с блестящим золотисто-желтым туловищем. Этот вид имеет серебристую роговицу глаз.
  • Рубиновая (красная) использовалась для выведения меченосцев. Этих рыбок очень часто используют для выведения новых видов. За исключением белого брюшка, анального и брюшного плавника все остальные части ярко-красного насыщенного цвета.

Встречаются и золотые, красные, нежно-красные светящиеся и другие рыбки с различными сочетаниями пятен разных форм и размеров.

Выбираем аквариум

При выборе домашнего местообитания пецилий исходим из следующего:

  • Для комфортного существования одной взрослой особи необходим объем воды около двух литров. Рыбки очень активные, быстро плавают, предпочитая верхние и средние слои воды, поэтому для содержания и ухода, аквариумным пецилиям требуется глубокий, широкий резервуар, объемом от 70 до 100 л.
  • Крышка или стекло с небольшими отверстиями – это обязательный элемент обустройства аквариума, чтобы разыгравшиеся рыбки не смогли выпрыгнуть наружу.
  • Растений должно присутствовать достаточное количество, чтобы молодняк смог укрыться от голодных взрослых особей. С целью образования зарослей используют роголистник, эхинодорус, элодею.
  • Грунт нежелателен, так как рыбки выделяют значительное количество экскрементов. Однако некоторые аквариумисты рекомендуют темную почву.

Совместимость

У пецилий дружелюбный и миролюбивый характер. Желательно заселять аквариум обитателями, сходными с ними по темпераменту, содержанию и уходу. Совместимость пецилий с нижеперечисленными аквариумными рыбками считается идеальной:

  • меченосцы;
  • петрушки;
  • скалярии;
  • данио;
  • дискусы;
  • боции.

Нежелательно совместное проживание с золотыми рыбками, цихлидами, карпами кои.

Проблемы в содержании

В основном уход и содержание пецилий никаких хлопот не доставляют. Это очень яркая неприхотливая рыбка.

При соблюдении правил (более подробно они описаны выше), а именно чистоты аквариума, определенной температуры воды, нормы кормления, рыбка будет прекрасно существовать, и размножаться в искусственных условиях. Однако в случае приобретения больной рыбки в течение недели она обычно погибает.

Особенности

Все тонкости по уходу и содержанию пецилий, фото которых представлены в статье, сводятся к следующему:

  1. Аквариум с объемом воды около 20 л достаточно освещать в течение двенадцати часов лампой на 15 Вт. Рыбки любят полумрак и прячутся в водорослях от яркого света.
  2. Температуру воды следует поддерживать от 20 до 26 градусов. При более низкой температуре они легко простужаются, при высокой – становятся неспособными к размножению.
  3. Жесткость воды должна находиться в пределах 8–25°, кислотность не более 7,5.
  4. Один раз в 14 дней надо заменять одну треть объема воды в аквариуме и добавлять на 10 л воды 5 г поваренной соли.
  5. Для насыщения аквариума кислородом и очистки воды от загрязнений подойдет любой компрессор и внутренний фильтр.

При соблюдении всех вышеперечисленных рекомендаций по уходу и содержанию пецилий они будут радовать вас в течение трех и более лет.

Питание

Пецилии всеядные, хорошо едят как сухой, так и живой корм. Единственное условие – разнообразное и сбалансированное питание. Любят полакомиться:

  • листьями одуванчика и салата, которые предварительно ошпаривают кипятком;
  • шпинатом;
  • кормом, содержащим спирулину;
  • пшеном и овсянкой, сваренной без добавления соли;
  • свежими огурцами и кабачками, мелко порезанными.

Растительная пища необходима рыбкам для хорошего пищеварения.

Из живого корма предпочитают мотыля, трубочника, дафнию, коретру, артемию. Корм рыбы захватывают с поверхности воды верхним ртом. Уход и содержание рыбки пецилии заключается и в правильном питании. Кормят их не больше двух раз в день маленькими порциями, которые они должны успеть съесть за пять минут. Покупая сухой корм в специализированных магазинах, надо внимательно смотреть на срок хранения и дату производства. Лучше всего приобретать пакетированный, а не развесной корм. Хранят коробки в закрытом виде, чтобы исключить развитие патогенной флоры.

Размножение

В возрасте пяти месяцев рыбки готовы к продолжению рода. На одного самца подселяют до двух самок. На длительность периода вынашивания икры и мальков оказывает влияние условия их содержания, и он может составлять от 10 до 60 дней, в среднем около 30 дней. У беременных самочек увеличивается в размере и становится темнее задняя часть брюшка.

Молодая мамочка с удовольствием поедает своих мальков. Для сохранения потомства перед родами ее отсаживают в другой аквариум, создавая условия, которые были описаны выше с единственной разницей – растительность должна быть гуще. За один раз рождается до 50 рыбок. После размножения пецилий содержание и уход за малышами такой же, как и за взрослыми особями. Мальки появляются на свет уже сформированными рыбками, способными жить самостоятельно. Питаются они тем же кормом, что и взрослые особи, а также в продаже присутствует специальный корм для мальков.

Заболевания

Пецилия, как и другие аквариумные рыбы, болеет:

  • незаразными болезнями, которые распространяются благодаря паразитам животного происхождения;
  • заразными (инфекционными) заболеваниями, вызванными вирусами, грибками и бактериями.

Причинами болезни являются:

  • Холодная вода в течение суток и более.
  • Несоблюдение основных правил ухода и содержания пецилий.
  • Некачественный корм, который может служить причиной инфицирования рыб, обитающих в аквариуме. Если не предпринять своевременно меры по спасению, они погибнут из-за быстрого распространения инфекции.

Болезни, которым подвергаются аквариумные пецилии:

  • Меланозис – это заболевание развивается из-за активной выработки организмом рыбы меланина, особого красящего пигмента. Болезнь не носит инфекционный характер и проявляется в виде маленьких черных пятнышек на плавниках и теле, которые впоследствии увеличиваются в размерах и трансформируются в опухолевые образования. Профилактика – это соблюдение условий по уходу и содержанию пецилий, а именно температурного режима и отбор здоровых и сильных особей. Больных пецилий следует отсадить в карантинную зону и содержать при минимально допустимой температуре, соблюдая режим кормления.
  • На теле рыб могут поселиться микроорганизмы, и со стороны это будет выглядеть как пуховые образования. Лечение: приготовить соленый раствор (в одном литре воды растворить около 20 г соли) и минут на 10 поместить в него больную рыбку. Паразиты сразу погибнут в такой среде. В карантинной зоне рыба должна находиться минимум пять дней, то есть до полного исчезновения признаков заболевания.
  • Появление на туловище рыбки темных пузырей и точек также сигнализирует о болезни. Пецилию следует обработать средством «Трипафлавин».

В качестве профилактики заболеваний рыбок помещают в раствор хлортетрациклина на 12 часов.

Аквариумные рыбки пецилии, содержание и уход за которыми несложные, доступны для разведения любому начинающему аквариумисту.

Пецилия — содержание, совместимость и размножение

Пецилия не менее популярна среди неопытных аквариумистов, чем Гуппи. Эта рыбка появились на территории Европы в начале 20 века. Она была завезена из Гватемалы и Мексики. Там, на родине, Пецилия живёт в реках, которые впадают в Атлантический океан. Принадлежит рыбка к семейству Карпозубых. Как же содержать рыбу в условиях аквариума? Чем ее можно кормить и с кем содержать? Как происходит размножение Пецилий? Давайте разберемся.

Дикий вид Пецилии имеет не такой яркий окрас, как ее потомки, которых разводят в аквариумах. Такие рыбки желто-коричневые с двумя темными пятнами возле хвостового плавника. Многолетнее разведение Пецилии в неволе и селекция способствовали получению гибридов, которые сохранили исходную форму тела, а окраску приобрели очень разнообразную. Сегодня есть Пецилии и с укороченным телом, и с плавниками разной формы. Существует больше десяти цветовых вариантов этой рыбки. Самые распространенные — крапчатая и желтая, красная с черными пятнами и зеленый шварц, красная и золотая Пецилия. Пецилия редиска отличается оригинальной формой хвоста. Посередине хвостового плавника есть широкая и узкая полоски. Пецилия баллон выглядит как раздутый вариант обычной рыбки. Этому виду характерны проблемы с размножением.

Размер взрослой особи Пецилии достигает 5 сантиметров в длину. Самцы по размеру меньше самок. У них широкие хвостовые плавники. Анальный плавник самца видоизменен. Он образует гоноподий, который используется при размножении.

Пецилии весьма подвижны.

Условия содержания

Содержание этой рыбки трудностей не представляет. Для стайки нужен аквариум от 50 литров. Его рекомендуется густо засадить растениями, однако и пространство для плавания оставить. Если вы хотите содержать лишь одну пару Пецилий, то вполне подойдет для этого пятилитровая банка.

Состав воды для содержания Пецилий особого значения не имеет. Она должна быть свежей, средней жесткости и со слабощелочной реакцией. Лучше, если температура воды в аквариуме будет до 25оС. Подмену воды на треть объёма надо делать один раз в неделю. Благотворно на здоровье Пецилий сказывается добавление в воду поваренной соли в дозировке 10-20 граммов на 10 литров.

При пониженных температурах воды возможно наступление у этого вида рыб простудных заболеваний и гнили плавников, грибковых заболеваний. Поэтому следует контролировать аэрацию и температуру воды в аквариуме, регулярно ее подменивать.

Что касается оптимального кормления Пецилии, то она всеядна. Ей можно давать мотыль и дафнию, трубочник и циклопа. С удовольствием ест сухие и живые корма, однако подкорм растительной пищей лишним не будет. Эта мирная рыбка уживается с такими же миролюбивыми обитателями аквариума и схожими по размеру.

Размножение

Этот процесс тоже трудностей не вызывает. Поскольку Пецилии — живородящие рыбы, то мальки на свет появляются уже сформированными.

Размножать рыб можно и в общем аквариуме. Для этого желательно, чтобы там были заросли мелколистных растений с целью укрытия мальков. Если производителям хватает корма, то свое потомство они не поедают.

При оптимальном питании самка вынашивает потомство полтора-два месяца. О том, что скоро на свет появятся мальки, можно определить по изменению окраса пятна выше анального плавника. Оно темнеет, а форма брюшка становится прямоугольной.

После родов самку обычно отсаживают. Общее количество мальков у одной самки достигает 80 штук. Стартовым кормом для них может служить коловратка и науплии артемии, циклоп и микрочервь, резанный трубочник и сухой корм для мальков.

Для выращивания малька нужны периодические подмены воды на отстоянную, что снизит уровень вредных органических соединений в аквариумной воде. Кормить молодняк нужно 4-5 раз в день. Так он быстрее растет, приобретает яркую окраску и здоровый вид.

Пецилии: уход и содержание | ЗООдиета правильное питание для животных

Аквариум для пецилий

Содержание статьи:

Пецилии содержатся в аквариумах любителей уже не одной десятилетие. Эти небольшие рыбки обладают яркой окраской и непритязательны в уходе.

Содержат их обычно группами от 6 особей. При этом самки должны преобладать. Минимальный рекомендуемый объем аквариума, учитывая высокую плодовитость вида – 40 литров. Рыбки очень прыгучие, поэтому позаботьтесь о наличии крышки или покровного стекла.

Украсить аквариум можно крупными камнями, натуральными корягами и живыми растениями. Небольшие укрытия позволят рыбкам прятаться в случае необходимости.

Чистая вода, насыщенная кислородом – залог долгой и здоровой жизни пецилий. Обязательно установите в аквариум фильтр и компрессор. Понадобится также терморегулятор, ведь пецилии любят тепло, а комнатной температуры может оказаться недостаточно.

Параметры воды

Наиболее комфортными параметрами воды для содержания пецилий являются:

  • Температура: 24-27°С;
  • Кислотность: 6.0-8.0;
  • Жесткость: 10-20.

Таким образом, пецилии это теплолюбивые рыбки, который не очень жалуют слишком мягкую воду. В воде с низкой жесткостью они чаще подвержены заболеваниям. Пецилии хорошо переносят небольшое повышение солёности, но подсаливать аквариумную воду специально следует лишь при лечении некоторых заболеваний.

Для поддержания высокого качества среды необходимо еженедельно подменивать до 20% от объема аквариума. Вода, которая используется для подмен, должна быть безопасна для гидробионтов. Наиболее популярным источником является водопровод. К сожалению, вода, текущая из-под крана, зачастую не соответствует нормам безопасности для аквариумных рыб. К примеру, она может содержать хлор, хлорамин, тяжелые металлы, которые токсичны для рыб и могут вызвать их гибель. Чтобы избежать нежелательных последствий использования водопроводной воды, воспользуйтесь кондиционером Tetra AquaSafe. Он моментально делает воду безопасной для рыб, а входящие в состав витамины и растительные коллоиды снижают стресс и защищаются слизистые оболочки рыб. Дозировка препарата: 5мл на 10 л свежей воды.

Свет

Пецилии предпочитают умеренное освещение, которое, с одной стороны, подчеркнет их красоту, а с другой – не станет дополнительным стимулом для роста водорослей. Хорошо подойдут современные светодиодные светильники с цветовой температурой 6000-6500 К.

Грунт

Сейчас читают

В аквариум с пецилиями вы можете поместить любой понравившийся грунт. Лучше всего, если он будет темным и не очень крупным, что хорошо скажется на росте живых растений. Рекомендуемый размер – 3-6 мм, насыпается субстрат слоем 4-6 см.

Растения

В природных водоемах пецилии предпочитают места с густыми зарослями водной растительности. Поэтому вдоль стенок аквариума высаживаются группы популярных аквариумных растений – криптокорин, эхинодорусов, элодеи, роголистника, валлиснерии и другие. Полезно завести плавающие на поверхности виды – риччию, пистию. Они станут отличным убежищем для мальков.

Кормление пецилий

Пецилии непривередливы в питании и отлично поедают любые виды кормов. Лучше всего остановить свой выбор на качественных сухих кормах, которые полностью сбалансированы и содержат разнообразные функциональные добавки, такие как витамины, натуральные усилители цвета и пребиотики. Широко известные живые и замороженные корма не могут похвастаться полноценностью, к тому же, являются потенциальными источниками инфекций в аквариуме.

Для ежедневного кормления пецилий и других мелких живородящих рыбок отлично подойдут Tetra Guppy Mini Flakes и Tetra Guppy Colour Mini Flakes. Эти полноценные корма в форме мини-хлопьев поддерживают здоровье, яркость окраса и жизненные силы рыб. Дополнительно обогащены растительными ингредиентами, играющими важную роль для комфортного пищеварения рыбок.

Хорошо подойдет пецилиям и базовый корм в форме хлопьев TetraMin Flakes. В его составе более 40 высококачественных компонентов, которые обеспечивают полноценный рост, здоровье и долголетие рыбок.

Для пецилий, в окрасе которых присутствуют красные, желтые или оранжевые оттенки, можно использовать корма с натуральными каротиноидами для придания дополнительной яркости – Tetra Rubin и TetraPro Colour.

Совместимость

Найти подходящих соседей для совместного содержания с пецилиями не составит особого труда. Эти миролюбивые рыбки хорошо сочетаются с большинством мирных соседей: гуппи, моллинезиями, меченосцами, радужницами. Скалярии, тетры, данио, гурами, барбусы также станут отличными соседями для пецилий.

Не рекомендуется содержать пецилий с крупными агрессивными цихлидами (акарами, астронотусами), которые могут легко проглотить маленьких живородок. Не стоит подсаживать к пецилиям и популярных холодноводных рыб: золотых или карпов кои.

Продолжительность жизни

В аквариумах пецилии живут порядка 3-4 лет.

This entry was posted in Рыбки. Bookmark the permalink. Креветка кристалл – полосатый чистильщик Меченосцы: уход и содержание Комментарии для сайта Cackle Статьи (блок)

Источник

17 видов, содержание и уход

Автор Volkova На чтение 9 мин Просмотров 3.4к. Опубликовано

Аквариумная рыбка пецилия входит в число самых популярных видов среди аквариумистов.

Компактные размеры, многогранность окрасов, мирный нрав пецилии идеально подходят для создания интересного видового аквариума.

Родина

Часть Центральной и юг Северной Америки — это основной ареал пецилий.

Там их можно в обилии встретить в пресноводных водоёмах, но и в низовьях рек, впадающих в Атлантический океан, они тоже с удовольствием поселяются.

Рыбки любят густую растительность и илистое дно. На полуострове Юкатан водятся самые красивые разновидности.

Описание и характеристики

Если посмотреть на фото дикой пецилии, особой декоративности не увидишь. Природный окрас рыбки довольно скромный: по бледно-жёлтому телу разбросаны коричневые вкрапления.

За многогранность и яркость красок следует благодарить селекционеров, которые упорно работали над внешним видом пецилий.

Длина тела рыбки варьируется от 3 до 12 см. Все виды относятся к живородящим.

Кардинально отличаясь окрасом, все они похожи в уходе и поведении. Живёт пецилия вариатус 3–5 лет.

Виды пецилий

Целеустремлённость селекционеров в создании новых разновидностей пецилии привела к тому, что сегодня насчитывается 130 её подвидов.

Среди поклонников этой рыбки наиболее популярны 17 из них. Давайте поближе познакомимся с этими удивительными красотками.

Пецилия белая

Белая пецилия редко встречается в продаже, поскольку в процессе размножения потомство не наследует фенотип родителей.

Отсутствие окраса связано с отключением генов, формирующих пигментацию кожи. Рыбка не просто белая: она почти прозрачная, сквозь её чешую можно рассмотреть внутренние органы.

Пецилия голубая или неоновая не такая редкая, как белая, но купить и её непросто.

Помимо приятного голубого оттенка, чешуя рыбки отливает неоновым светом, усиливая её декоративный облик.

Высокоплавничная

Этот вид был получен от скрещивания обыкновенной пецилии и флагового меченосца.

Главная особенность рыбки — высоко выступающей спинной плавник. В окрасе возможны различные вариации.

Гавайская

Гавайская пецилия был выведена в 1962 году. Тело рыбки может быть окрашено в чёрный или жёлтый цвет, а хвост у всех разновидностей красный. Плавники могут быть жёлтыми либо прозрачными.

Баллон

В отличие от стройных форм прочих представителей семейства, баллон выглядит как шарик с хвостом и головой.

Смотрится она экзотично и даже уродливо, но обилие цветовых решений компенсируют странную форму рыбки.

Интересно! Мальки баллона рождаются с прямым позвоночником, но в процессе роста он искривляется, придавая рыбке округлые очертания. К баллону нужно подселять малоподвижных соседей: сам он плавает довольно неуклюже.

Редиска

Выведена в 70-х годах прошлого века. Классический окрас — красное тело и чёрный хвост, но встречаются и другие вариации. Отличительная деталь облика — ромбовидная форма хвоста.

Чёрная

Абсолютной черноты, как в случае с моллинезией, в окрасе пецилии нет. У неё чёрный цвет дополнен красными, оранжевыми и различными светлыми оттенками плавников и хвоста.

Трёхцветная

Трёхцветная окраска пецилии складывается из нескольких комбинаций: голубого с жёлто-зелёным и чёрного с жёлтым и оранжевым.

Распределение цветов непредсказуемо и не носит чётких границ. Длина рыбки 7 см.

Важно! Любит густые заросли растений, где она прячется от врагов и уединяется для размышлений.

Парусная велифера

Разновидность высокоплавничной пецилии, у которой плавник трансформирован в широкий парус, гордо развевающийся над спиной.

Окраска тела представлена несколькими оттенками: жёлтым, шоколадным, серебристым. Очень подвижная рыбка, но если она легла на дно, значит, у питомца проблемы со здоровьем.

Пятнистая

В окраске и размерах пятнистый вид недалеко ушёл от параметров дикой пецилии.

Однако стараниями селекционеров он приобрёл апельсиновый оттенок тела, по которому причудливо разбросаны тёмные пятнышки. Предпочитает просторный аквариум, где может свободно резвиться.

Интересно! Пятнистостью обладает и пецилия рижская, у которой по ярко-оранжевому телу идут тёмные пятнышки разного размера.

Дисковая

Главная примета вида — дисковидное тело. Размеры у рыбки небольшие, не более 3 см в длину, при этом самки заметно больше самцов.

Основной цвет тела — красный, плавники могут быть окрашены в чёрные или красные оттенки. Пецилия дисковая, как и баллон, рождается с прямым позвоночником.

Такими же размерами обладают и микропецилии, или пецилии Браннера. Плавают они стайками, обладают вариативным окрасом.

Жёлтая

Пецилия жёлтая — крупный представитель рода. Длина тела особей может достигать 10 см.

Солнечные оттенки основного окраса красиво разбавлены алыми плавниками.

Неоновая

Радужная или неоновая разновидность ведёт стайный образ жизни. Превалирующие цвета в окрасе тела — голубой или синий.

Плавники имеют тёмные оттенки. Неоновый эффект проявляется в свечении чешуи под разными углами освещения.

Чернохвостая

Чернохвостый вид дал жизнь многим селекционным разновидностям пецилий. Длина тела рыбки — 12 см. Окрашена классически: тело красное, а плавники чёрные.

Оба цвета отличаются насыщенностью и глубиной. Для сохранения эффектного окраса рыбу кормят только живым кормом.

Микки маус

Селекционеры вывели рыбку с необычным окрасом, и, увидев, что у них получилось, назвали её Микки Маусом.

И действительно: ближе к хвосту мы отчётливо видим мордочку знаменитого мультипликационного героя, составленную из одного большого и двух маленьких чёрных пятнышек.

Основной тон тела варьируется от золотого до голубого.

Сансет

Сансет, или ситцевая пецилия, редко поступает в зоомагазины. Рыбка с оригинальным рисунком, в котором жёлтый тон плавно переходит в красный.

Ситцевый принт отмечается тёмными пятнышками по бокам и чёрной каймой красно-жёлтых плавников. Самцы, как правило, окрашены ярче самок.

Тукседо

У Тукседо благородная окраска, в которой серебро на спинке и брюшке гармонично перетекает в глубокую синь боков. Это крупные рыбки с длиной тела до 10 см.

Красные

Настоящая красная пецилия — это рыбка, у которой в главенствующий цвет окрашены все части цвета.

Иногда плавники могут быть прозрачными. Особи с красным телом и чёрными плавниками относятся к другому виду.

Это интересно! Благодаря селекции красных пецилий учёные получили красных меченосцев, которые в природе всегда окрашены в зелёные тона.

Отличия пецилии от моллинезии

Несмотря на схожесть форм, моллинезии проигрывают пецилиям в многообразии окраса. Первые могут похвастать лишь чёрным, золотым и белым цветом тела.

Кроме того, приглядевшись, можно заметить, что анальное отверстие у моллинезий отстоит от хвостового плавника дальше, чем у пецилий. Есть отличия и в поведении — пецилии намного дружелюбнее.

Совместимость

Легко подружатся они с тетрами, радужницами, кардиналами, неонами, гурами, сомиками. Но идеальными соседями для пецилий станут близкие родственники:

  • меченосцы;
  • моллинезии;
  • гуппи.

Противопоказано содержание мирных и беззащитных пецилий с крупными хищниками и другими агрессивными видами типа барбусов, цихлид, петушков, астронотусов.

Содержание

Если вы хотите обеспечить пецилии правильное содержание и уход, селите рыбок стайками.

Только в обществе себе подобных они чувствуют себя защищёнными, активно развиваются и живут в гармонии. Главное — создать для питомцев комфортную среду.

Параметры содержания

Организуя водное жилище пецилии, температуру в нём поддерживают в районе 20…25 °С. Жёсткость воды составляет 8–25 dH, кислотность — 7,5–8 pH.

Подмена воды желательна каждую неделю в объёме 1/3 от всего количества. Аэрация и свет должны быть умеренными.

Обустройство аквариума

Для пецилий, ведущих стайный образ жизни, нужен вместительный резервуар. На 5-6 рыбок потребуется не менее 60 литров.

В качестве грунта подойдёт мелкая галька или речной песок в тёмных тонах.

Растительность густая, но высаженная по задней стенке аквариума. Пецилиям нужно оставить свободное пространство для плавания. Отличную зелёную зону составят:

Для декорирования можно использовать крупные округлые камни или коряги.

Питание

Пецилий кормят обычными кормами (трубочник, дафния, коловратки, мотыль), добавляя в рацион растительную пищу.

Частота кормлений — 2 раза в сутки. Порция должна быть такой, чтобы рыбки всё съели за 10 минут.

Внимание! Чтобы упрочить здоровье питомцев и предотвратить ожирение, раз в неделю им устраивают разгрузочный день.

Размножение

В размножении пецилий особого внимания от владельца требует уход за мальками.

Живородящие рыбки сами справляются с их появлением на свет, а вот выкармливание и содержание молоди ложится на плечи хозяина питомцев.

Отличия самца от самки

В стае питомцев легко отличить самочку от самца. Она заметно крупнее и телом округлее, но окрашена бледнее.

Её анальный плавник больше, а у самца он совмещает две функции — гоноподия и собственно плавника.

Нерест

Хотите увидеть, как рожают пецилии — подготовьте для них небольшой нерестовик. Посадите в него одного самца и трёх самочек.

Через некоторое время все они будут оплодотворены самцом. На формирование мальков в брюшке мамы потребуется 28 дней.

Самца отсаживают, а вот самочек можно оставить в нерестовике. Об удачной беременности самки можно узнать по округлению брюшка и появлению тёмной точки у анального плавника.

Ближе к родам нерестовик нужно прикрыть тканью, чтобы обеспечить рыбкам спокойную обстановку. Мальки рождаются физически сформированными и готовыми к самостоятельному плаванию.

Мальки

После рождения мальков маму убирают. На начальном этапе роста молодь кормят варёным желтком и измельчённой дафнией.

Через 1,5–2 недели переводят на взрослую пищу. Содержат в нерестовике до трёхмесячного возраста, обеспечив необходимый уход за водоёмом.

Заболевания

Обладая хорошим иммунитетом, пецилии болеют редко. Однако нарушения в параметрах содержания могут привести к инфицированию рыбок паразитами и грибками.

Плавниковая гниль

Опасная болезнь, начинающаяся с поражения плавников и распространяющая своё негативное воздействие на внутренние органы рыбки. Внешние признаки гнили:

  • слипание плавников;
  • серые язвы;
  • некроз тканей.

Главная профилактика заболевания — тщательное соблюдение санитарных норм.

Ихтиофтириоз (манка)

Инфекция отмечается мелкой белой сыпью на теле, похожей на манную крупу. Часто проникает в водоём с грязным кормом. Успешно излечивается малахитовой зеленью.

Нематоды

Глисты редко поражают пецилий, но во избежание заражения следует регулярно добавлять в воду антисептики, соблюдая необходимую дозировку.

Ватная болезнь

Грибковая инфекция, проявляющаяся пушистым белым налётом на теле рыбки. Для избавления от грибка применяют солевые ванны или добавляют в воду противогрибковые препараты.

Красивые, миролюбивые и забавные пецилии доставляют много радости своим владельцам. Они плавают весёлыми стайками, легко размножаются и редко болеют. Такие питомцы украсят любой аквариум.

Пецилии: описание, виды, содержание, кормление, разведение

Post Views: 1 605

Пецилии (лат. Poecilia) – небольшие привлекательного вида рыбки, которые относится к роду Xiphophorus (Меченосец), семейство Poeciliidae (Пецилиевые). Поэтому с точки зрения науки правильнее называть данных рыбок меченосцами, но историческое наименование плотно закрепилось в среде аквариумистов, поэтому применяется гораздо чаще.

Раньше (1 половина 20 века) пецилий относили к отдельному роду Platypoecilus. На сегодняшний день он был аннулирован. Именно от названия рода пецилии унаследовали свое второе название – Плятипецилии. В англоязычных странах их по-прежнему называют Platy.

Сегодня существуют множество видов пецилий. Однако все они – селекционные разновидности всего двух видов – Пецилии макулатус (Xiphophorus maculatus) и Пецилии вариатус (Xiphophorus variatus).

Пецилия макулатус (Xiphophorus maculatus)

Пецилия вариатус (Xiphophorus variatus)

Интересно, что согласно современной классификации пятнистая пецилия (Xiphophorus maculatus), была отнесена к роду Меченосец (Xiphophorus). Некоторые популярные сегодня селекционные виды пецилий появились именно благодаря скрещиванию с меченосцами. А самым известным представителем пецилий является флаговая или высокоплавничная.

Если раньше селекционную работу и гибридизацию вели специалисты из Европы, то сегодня это прерогатива селекционеров из стран Азии. Именно здесь создаются новые породы с различными цветовыми вариациями.

Пецилии, независимо от вида, давно полюбились аквариумистам, благодаря своей неприхотливости. Это живородящая рыбка, она не мечет икру, у самок рождаются уже сформировавшиеся мальки, что значительно упрощает разведение. Именно с пецилий или других схожих видов новичку нужно начать знакомство с аквариумистикой.

Строение и внешний вид пецилий

Рыбки имеют небольшой размер. В условиях аквариума они могут вырасти до 5 см в длину. Тело укороченное, хвостовой плавник достаточно широкий. В природе естественная окраска пецилий не очень яркая – основная желто-коричневая, а у хвоста расположены два темных пятна. Однако благодаря селекционной работе существует большое разнообразие окрасок у аквариумных пецилий – это красная, желтая, черная, пятнистая и др. Удалось добиться и выведения пород с измененной формой тела и плавников, например, баллоны (искривленный позвоночник и округлое выпирающее брюшко), вуалевые пецилии (для них характерна удлиненная форма спинного плавника).

Ареал обитания пецилий

Природная среда обитания пецилий – это водоемы на территории Центральной Америки (Гватемала, Мексика) и Южная часть Северной Америки (американские штаты Флорида, Калифорния, Колорадо). Это пресноводная рыбка, но она также сумела адаптироваться к жизни в воде с повышенной соленостью. Поэтому ее можно встретить в устьях рек, которые впадают в Атлантический океан. Рыбки предпочитают территории биотопов, имеющих илистый грунт и густые заросли растений. Место обитания самых привлекательных по внешнему виду особей – полуостров Юкатан.

История

В Европу рыбки были завезены из Мексики и Гватемалы в начале ХХ века (1907 год). Пецилий пятнистой формы завезли в Европу  в конце 19 — начала 20 века. В начале 40-х годов особую популярность получила  чёрная форма рыбок, которая была выведена в США.

Популярные разновидности аквариумных пецилий

Пецилия Микки Маус 

Основная окраска тела этого вида рыбок может быть самой разной – от голубых, красных до золотистых оттенков. Главная их особенность – это пятнышки, расположенные у основания хвостового плавника. Там присутствует одно черное пятно крупных размеров и два небольших по бокам. Их расположение напоминает силуэт головы Микки Мауса – героя мультфильмов. Эта схожесть и дала название виду. Размеры рыбки – 5-7 см.

Пецилия черная

Основная окраска тела рыбки имеет черный цвет. Однако пецилии никогда не бывают полностью черными. Более светлые тона от красного и оранжевого до золотисто-желтого присутствуют на хвосте, плавниках, в зоне головы. Размер представителей этого вида – 5-7 см.

Пецилия красная

Эти рыбки имеют полностью красную окраску, включая хвост и спинной плавник. Некоторые ошибочно относят к этому виду рыбок с красной окраской, но черным хвостовым плавником. На самом деле, это не правильно, поскольку такие рыбки относятся к другому виду. А красная пецилия – полностью окрашена в красный цвет. Представители этого вида достигают размера – 5-7 см.

Пецилия белая

Окраска тела рыбки не имеет никаких цветов, кроме белого. Во время селекционной работы словно «отключили» работу генов, отвечающих за цветовую пигментацию тела. Через чешую порой даже просматриваются красные жабры и внутренние органы. Но при этом плавники могут отличаться от тела окраской. Это очень редкий вид, поскольку фенотип почти не передается потомству. Размер рыбки – 5-7 см.

 

Пецилия голубая

На теле рыбки присутствует голубоватая окраска с очень эффектным неоновым или металлическим отливом. Отвечают за такую окраску клетки – иридофоры. Взрослая особь достигает размера 5-7 см.

Пецилия баллон

Этот вид рыбок выделяет необычная форма тела. Оно укорочено и имеет искривленный позвоночник. Рыбка имеет выпирающий округлый живот, и вся форма тела практически округлая. Цветовых вариаций баллонов существует множество. Из-за своей формы рыбки немного неуклюжи, поэтому не рекомендуется в качестве соседей выбирать для них очень подвижных рыб. Размер представителей этого вида – 5-7 см.

Условия содержания пецилий

Пецилии – неприхотливые рыбки, но чтобы они чувствовали себя комфортно, были здоровыми и хорошо размножались, необходимо позаботиться о создании подходящих условий. В комфортных условиях, в неволе,  продолжительность жизни составляет 3-4 года.

Объем аквариума

Подбирать аквариум по объему следует, исходя из расчета, на одну пару пецилий не менее 15 л. Это стайные рыбки, рекомендуется держать их группами не менее 6 особей. Поэтому и объем аквариума должен стартовать — от 60 л. Также следует учесть, что они достаточно плодовиты. Аквариум должен быть оснащен крышкой, поскольку пецилии активны и могут выпрыгнуть.

Свет

Для рыбок будет достаточно естественного дневного освещения, без попадания прямых солнечных лучей. Но если аквариум находится в затененной зоне, то рекомендуется установить небольшую лампу. Так же необходимо учитывать и наличие растений в емкости, интенсивность освещения подстраивать именно под них, оформляя рыбкам затененные участки.

Требования к воде

Необходимо хорошо насыщать воду кислородом. Она должна быть достаточно жесткой, потому что в мягкой воде рыбки становятся более уязвимы к заболеваниям. Оптимальные параметры: температура 24-27°C, общая жесткость 10-20° dGH и  pH до 8. Подмена воды осуществляется раз в неделю в размере около 20-30% от общего объема аквариума.

С подсаливанием воды следует быть очень аккуратными. Начинающим аквариумистам вообще лучше воздержаться от применения соли! Опытные аквариумисты могут периодически использовать соль в лечебных и профилактических целях, при условии, что это видовой аквариум или остальные его обитатели также хорошо переносят повышение солености.

Каким должен быть грунт

Выбирать грунт лучше темного цвета, а добавление в него мраморной крошки поможет немного повысить жесткость. Размеры гранул 3-5 мм, чтобы удобно было сажать растения, без острых краёв. Лучше выбирать специально заготовленные аквариумные грунты.

Растительность и декорации

Поскольку в природных условиях рыбки обитают на участках с густой растительностью, то схожие условия рекомендуется создать и в аквариуме. Обязательно должны присутствовать островки густых зарослей. Для их создания можно использовать роголистник, криптокорины, элодею, эхинодорусы и другие пышные растения. А заросли риччии станут отличным укрытием для мальков. Но не забываем, что необходимо оставить достаточно пространства для свободного плавания.

Оборудование

Стандарт: Фильтр (внешний или внутренний, зависит от объема аквариума), терморегулятор – от резкого понижения температуры или если в помещении прохладно, термометр, аэратор — по необходимости.

Кормление

Этот вид рыб всеяден. В природе пецилии питаются мелкими насекомыми и водорослями. Клетчатка является обязательной составляющей их рациона, поскольку она необходима для хорошей работы ЖКТ.

Если вы содержите пецилий в аквариуме, отлично подойдут корма в виде хлопьев, палочек, гранул и даже таблеток. Из живых и замороженных идет: артемия, мотыль, трубочник, аулофорус, энхитреус, коретра, дафнии и все те, которые подходят по размеру. Также кроме обычных белковых кормов необходимо давать растительные. Если в аквариуме мало растений и декораций, где поселяются водоросли, которые охотно объедают пецилии, подкормка растительными кормами обязательна.

Порции должны быть небольшими, чтобы рыбки съедали их за несколько минут. В идеале сухой корм вообще не должен опускаться на дно. Кормление осуществляется от 1 до 2 раз в день. Не забываем про разгрузочные дни – один раз в неделю. В этот день рыбки в плане кормления предоставлены сами себе, прочесывая аквариум в поисках пищи.

Совместимость

Миролюбивость – одно из достоинств пецилий. Они способны хорошо уживаться не только со своими сородичами, но и рыбами других видов. Наиболее благоприятное соседство будет с такими «сожителями»: меченосцы, гуппи, радужницы, моллинезии, некоторые сомики. Возможно соседство с гурами, барбусами, тетрами, и скаляриями. Обустройте в аквариуме достаточно укрытий.

Абсолютно несовместимы с агрессивными акарами, астронотусами, а также с холодноводными рыбками (золотые, карпы кои и др.).

Особенности разведения и размножения пецилий

Пецилии являются живородящими рыбками и, как и у всех живородок, у них ярко выражены половые признаки. Самки отличаются менее красочной окраской и более крупными размерами, их брюшко более округлое. Самцы не только значительно меньше самок, но и более яркие, самое важное отличие – это имеющийся у них гоноподий. Это орган, позволяющий оплодотворять самок – он служит своеобразным желобом, по которому половые продукты попадают в брюшко самки. А чтобы самцу было легче удерживаться возле самки во время оплодотворения, на конце гоноподия имеется специальный крючок.

Выбор производителей

Поскольку половые признаки у пецилий ярко выражены, то выбрать пару для разведения не составит труда. Половая зрелость наступает в возрасте 5-6 месяцев. Следует отбирать самых красивых, крупных и здоровых особей, если вы планируете отсаживать их из общего аквариума. Но на самом деле отсадка на этапе оплодотворения и созревания икринок в брюшке самки не обязательна. Созревание икринок длится около 1-2 месяца. Когда самка готова к нересту, то ее пятно, рядом с анальным плавником, становится более темным, а брюшко приобретает прямоугольную форму. Потемнения на животе, рядом с анальным отверстием, может и не быть, всё зависит от расцветки самки.

не беременная самка живородки

беременная самка живородки

Условия при нересте

У самки может родиться до 100 мальков. Все зависит от ее возраста и размера. Отсадка оплодотворенной самки поможет максимально сохранить потомство. Каких-то особых условий в нерестилище создавать не требуется. Вода подойдет из общего аквариума, высадить немного мелколистных растений, которые будут служить малькам укрытием и позаботиться о фильтрации, аэрации  (поможет аэрлифтный фильтр) и подменах воды.

Процесс нереста

Процесс стандартный для всех живородящих рыбок. Уже сформировавшиеся мальки способны сразу питаться самостоятельно. Самку после нереста рекомендуется сразу вернуть в общий аквариум, чтобы она не съела свое потомство.

Кормление мальков

Кормить мальков следует не менее 4-6 раз в день. Лучшее решение – качественный специализированный корм для мальков, подходящей фракции и живые корма, например для новорожденных: нематода, науплии артемии, для подросших — аулофорус, мелкие дафнии, гриндаль. Регулярное кормление качественным кормом обеспечит быстрый рост мальков.

Более подробно о кормах и кормлении мальков живородящих рыбок можно прочитать в этой статье


Наш канал на Ютубе — https://www.youtube.com/channel/UCGZLHMYHlQuAxG_RpCSvNJg/

Наш канал на Рутубе — https://rutube.ru/channel/995865/

Наш Блог — https://aqua-tropica.ru/

Культуры живых кормов и растения — https://aqa-shop.ru/

Группа в ВК — http://vk.com/aqa_korma_dlya_ryb

Группа в Одноклассниках — https://ok.ru/group/58362154713266


«Новый вид рыб Poeciliid рода Poecilia из Эспаньолы», Луис Р. Ривас

 

Альтернативное название

Новый вид пецилиевых рыб рода Poecilia из Эспаньолы, с восстановлением и переописанием P. dominicensis (Evermann and Clark)

Аннотация

Обсуждаются исследования ручьев и озер Эспаньолы и имеющиеся коллекции пецилиевых рыб с этого острова, а также таксономическая история и родовой статус двух описанных видов.Роды Limia и Mollienesia были синонимизированы с Poecilia Розеном и Бейли (1963), а прежний Mollienesia dominicensis Эверманна и Кларка (1906) стал младшим омонимом Valcienne (Limia domini1censis 80015) (16015 Limia domini1censis 80016) . Поэтому Розен и Бейли переименовали M. dominicensis Evermann and Clark в Poecilia montana . Поскольку Mollienesia здесь сохранен как синоним Poecilia , но Limia восстановлен как действительный род, Poecilia dominicensis Evermann и Clark больше не является младшим омонимом Limia dominicensis Valenciennes.Таким образом, название montana становится младшим объективным синонимом dominicensis Эверманна и Кларка. Описанный здесь новый вид, хотя и был доступен предыдущим авторам, до сих пор путали с Poecilia dominicensis Evermann and Clark. Оба вида внешне похожи, но четко различаются и более тесно связаны друг с другом, чем любой из других видов Poecilia . Они ограничены островом Эспаньола и демонстрируют смещение характера в нескольких местах, где они встречаются вместе.

Рекомендуемая ссылка

Ривас, Л. Р. 1978 год. Новый вид пецилиевых рыб рода Poecilia из Эспаньолы с восстановлением и переописанием P. dominicensis (Эверманн и Кларк). Наука Северо-восточного залива 2 (2).
Получено с https://aquila.usm.edu/goms/vol2/iss2/2

ЗАГРУЗКИ

С 12 мая 2018 г.

МОНЕТЫ

 

Геном тринидадской гуппи, Poecilia reticulata, и вариации в популяции гуанапо

Abstract

На протяжении более века живородящие гуппи, Poecilia reticulata , использовались для изучения полового отбора, а также местной адаптации.Естественные популяции гуппи отличаются многими чертами, имеющими интуитивное адаптивное значение, такими как орнаментация, возраст взросления, размер выводка и форма тела. Глубина воды, обеспеченность светом, пищевые ресурсы и режим хищничества формируют эти черты, а барьерные водопады часто разделяют контрастные среды в одной и той же реке. Мы собрали и аннотировали геном инбредной одиночной самки из участка с высоким уровнем хищничества в бассейне реки Гуанапо. Окончательная сборка содержит 731,6 Мб с скаффолдом N50 из 5.3 МБ. Каркасы были сопоставлены с группами сцепления, поместив 95% сборки генома на 22 аутосомы и Х-хромосому. Чтобы исследовать генетическую изменчивость в популяции, используемой для сборки генома, мы секвенировали 10 самцов, пойманных в дикой природе. Идентифицированные 5 миллионов SNP соответствуют среднему разнообразию нуклеотидов ( π ) 0,0025. Сборка генома и карта SNP предоставляют богатый ресурс для исследования адаптации к различным режимам хищничества. Кроме того, сравнения с геномами других видов пецилиевых, которые сильно различаются по механизмам определения пола и распределения материнских ресурсов, а также сравнения с другими родами костистых рыб могут начать показывать, как у костистых рыб развивалось живорождение.

Образец цитирования: Künstner A, Hoffmann M, Fraser BA, Kottler VA, Sharma E, Weigel D, et al. (2016) Геном тринидадской гуппи, Poecilia reticulata , и вариации в популяции гуанапо. ПЛОС ОДИН 11(12): е0169087. https://doi.org/10.1371/journal.pone.0169087

Редактор: Пэн Сюй, Сямэньский университет, КИТАЙ

Получено: 15 июня 2016 г .; Принято: 12 декабря 2016 г.; Опубликовано: 29 декабря 2016 г.

Copyright: © 2016 Künstner et al.Это статья с открытым доступом, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

Доступность данных: Все краткие данные чтения, созданные в ходе этого проекта, были доступны через Архив кратких чтений NCBI (исследование SRA NCBI, доступ SRP038017). Номера доступа для геномных библиотек можно найти в таблице S1, а для популяционных образцов — в таблице S2.Номера доступа для образцов, используемых для оценки частоты мутаций: SRR1503964 и SRR1503965 для родителей (самка, мужчина) и SRR1503967-SRR1503971 для пяти F1. Сборка генома была представлена ​​в NCBI в рамках BioProject PRJNA238429. Весь проект был депонирован в DDBJ/EMBL/GenBank под регистрационным номером AZHG00000000. Версия, описанная в этом документе, — это версия AZHG01000000. Сборка включает группы сцепления с 1 по 23, все неразмещенные последовательности и митохондриальный геном. Образцы каркаса отображаются в строке WGS_SCFLD в нижней части основной записи WGS, AZHG00000000 (CM002706-CM002728 = хромосомы, KK214999-KK218026 = каркасы).

Финансирование: Эта работа была поддержана Премией Готфрида Вильгельма Лейбница Немецкого исследовательского сообщества и Общества Макса Планка. Спонсоры не участвовали в разработке исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Конкурирующие интересы: Авторы заявляют об отсутствии конкурирующих финансовых интересов.

Введение

Появление экономичных и высокопроизводительных технологий секвенирования привело к тому, что геномика стала областью эволюционной биологии.В сочетании с прогрессом в области вычислительной биологии секвенирование следующего поколения позволяет исследователям изучать близкородственные популяции или виды с помощью полного секвенирования генома (например, [1], [2]), исследовать, как геномная изменчивость структурирована между видами и внутри них, а также определять как геномная изменчивость связана с фенотипической и средовой изменчивостью (например, [3–5]). Обладая этой информацией, мы теперь можем решать фундаментальные вопросы эволюционной биологии, например, как популяции адаптируются к новым или меняющимся условиям, обусловлены ли признаки несколькими генами с большим эффектом или многими генами с малым эффектом, и каково относительное значение демографии и отбора. находятся в формоизменении.

Первым важным шагом, необходимым для решения этих вопросов, является создание высококачественного эталонного генома. Несмотря на то, что существует множество «безэталонных» методов изучения генетической изменчивости (например, сборка транскриптома de novo RAD-seq, de novo [6, 7]), им присущи существенные недостатки, такие как ограниченная информация о сцеплении между гены, неоднозначность ортолога-паралога, трудности в дифференциации потери гена из-за недостаточной выборки и неправильной аннотации [8].Некоторые из этих проблем, вероятно, будут особенно неприятными для костистых рыб, потому что событие дупликации всего генома произошло на раннем этапе диверсификации костистых рыб, и с тех пор различные линии независимо претерпели дополнительные дупликации генома.

В дополнение к базальной дупликации всего генома, за которой следует редиплоидизация, что, в свою очередь, приводит к потере дополнительных копий, функциональная диверсификация и неофункционализация копий паралогичного гена являются характерными чертами эволюции генома костистых рыб [9, 10] (обзоры в [11]).По этой причине, а также из-за огромного количества разнообразных видов этого класса, костистые рыбы представляют собой богатый ресурс для изучения эволюции молекулярной функции генов и организации всего генома. Следовательно, непрерывная, аннотированная эталонная сборка генома является еще одной вехой в эволюционной биологии рыб [12].

Здесь мы сосредоточимся на тринидадской гуппи ( Poecilia reticulata ) как на главной модели позвоночных для изучения естественной изменчивости и местной адаптации.Тринидадская гуппи — это небольшая живородящая пресноводная рыба с выраженным фенотипическим диморфизмом между полами и системой определения пола XX/XY. В отличие от незаметного сетчатого узора более крупных самок, сложные узоры взрослых самцов сильно различаются внутри разных природных популяций и между ними (рис. 1). Неудивительно, что гуппи были одним из первых видов позвоночных, для которых удалось продемонстрировать сцепленное с полом наследование признаков [13].

Сравнительные исследования показали, что гуппи конвергентно развили схожие приспособления к жизни с хищниками или без них в разных реках, впадающих со склонов Северного хребта в Тринидаде.Эти адаптации включают окраску самцов, брачное и школьное поведение, а также особенности жизненного цикла [14, 15]. Популяционно-генетические исследования показали, что естественные популяции с низким уровнем хищничества возникают в результате независимых событий колонизации предковыми популяциями ниже по течению и с высоким уровнем хищничества в пределах каждого речного стока [16, 17]. Режим хищничества считается основной движущей силой адаптации. Некоторые хищники в местах, расположенных ниже по течению, охотятся преимущественно на крупных взрослых гуппи, способствуя эволюции самцов гуппи с меньшей окраской и тактикой скрытого спаривания.Барьеры исключают этих хищников из местностей выше по течению. Немногочисленные хищники, обитающие здесь, преимущественно киллифиш Rivulus hartii , едят меньше гуппи и, как правило, охотятся на более мелких неполовозрелых рыб. В этих условиях половой отбор в виде предпочтений самок преобладает над естественным отбором хищников, и самцы эволюционируют, приобретая более яркую окраску [14, 15, 18]. Когда гуппи пересаживают из мест с высоким уровнем хищничества в места с низким, измеримые сдвиги признаков происходят в течение трех-десяти поколений [19, 20], что свидетельствует об отборе из постоянной естественной изменчивости в популяциях-основателях [14, 18, 21, 22].Постоянная генетическая изменчивость обеспечивает богатый репертуар аллелей, который позволяет проводить отбор полезных аллелей, улучшающих приспособленность к меняющейся среде. Благодаря сохранению древней генетической изменчивости или текущего потока генов полезные аллели уже прошли «селекционный фильтр» [23]. Кроме того, адаптивные аллели могут поддерживаться на высоких частотах благодаря уравновешивающему отбору. Было показано, что негативный частотно-зависимый отбор действует у гуппи, у самцов с редким окрасом вероятность выживания выше [24] и выше преимущество при спаривании [25].

Гуппи имеет гаплоидный набор из 23 хромосом с системой определения пола XX/XY. В начале 20-го века Виндж использовал скрещивания инбредных линий гуппи, чтобы показать, что многие окрасы самцов являются Y-сцепленными [13, 26]. Более поздние исследователи использовали количественные генетические подходы, чтобы показать, что самцы оказывают гораздо большее влияние, чем самки, на наследование размера и окраски самцов [27–29], что снова доказывает, что эти черты частично контролируются Y-сцепленными генами. Совсем недавно Tripathi и коллеги [30] использовали классический количественный генетический каркас F 2 с приблизительно 800 маркерами и 2000 индивидуумов для картирования QTL признаков размера и окраски.Они обнаружили, что несколько областей, связанных как с размером, так и с цветом самцов, связаны с локусом, определяющим пол, но также обнаружили ряд дополнительных QTL на разных аутосомах. Модели эволюции половых хромосом предсказывают, что гены, которые приносят пользу только гетерогаметному полу, такие как гены заметной окраски, будут иметь повышенную эволюционную приспособленность, если физически связаны с локусом, определяющим пол, путем подавления рекомбинации [31]. Исследование структуры половых хромосом различных популяций гуппи и измерения синаптонемных комплексов выявили полиморфизм между X- и Y-хромосомами [32].Половые хромосомы гуппи считаются относительно молодыми, потому что X- и Y-хромосомы в большинстве популяций морфологически не различаются, несмотря на то, что многие гены, по-видимому, связаны с нерекомбинирующей частью Y-хромосомы [33–35]. Следовательно, расширенные псевдоаутосомные области продолжают обмениваться между X и Y [33, 35].

Как эволюция детерминации пола у этого вида, так и генетическая основа местной адаптации в значительной степени выиграли бы от высококачественной сборки генома.Поэтому мы секвенировали и собрали эталонный женский геном, используя комбинацию парных концов, парных пар и библиотек fosmid. Подавляющее большинство сборочных каркасов затем было размещено путем генетического сцепления с 22 аутосомами и Х-хромосомой. Кроме того, мы описываем генетическую изменчивость, обнаруженную в исходной популяции эталонного генома, на участке с высоким уровнем хищничества у реки Гуанапо на северо-западе Тринидада.

Материалы и методы

Сборка генома и аннотация

Отбор проб и содержание рыб-основателей.

Рыбами-основателями инбридинга были выращенные в лаборатории гуппи первого поколения из Нижней реки Гуанапо (Twin Bridge North West Trinidad, PS 77800), где они не находятся ни под угрозой исчезновения, ни под защитой. Образцы были любезно подарены доктором Дэвидом Резником из Калифорнийского университета в Риверсайде в 2009 году. Сбор и экспорт этой рыбы были одобрены Министерством сельского хозяйства, земельных и морских ресурсов Республики Тринидад и Тобаго в соответствии с их законодательством. С тех пор их коллекционное потомство хранилось и разводилось в Институте биологии развития им. Макса Планка в Тюбингене в соответствии с законодательством Германии.Объект был одобрен Regierungspräsidium Tübingen, регистрационный номер 35/9185.46. Рыбу, необходимую для получения ДНК, анестезировали смертельной дозой MS222 перед помещением на хранение в 95% этанол.

Секвенирование генома.

ДНК самок 5-го поколения -го поколения использовали для приготовления библиотек парных концов Illumina с размерами вставок от 240 до 460 п.н., а также использовали ДНК потомков самок той же линии в поколениях с 6-го по 8-е (всего шесть особей). для создания библиотек гибридных сопряженных пар Roche/Illumina длиной от 3 до 20 т.п.н.; подробнее см. [36].Вкратце, библиотеки сопряженных пар готовили путем лигирования адаптера для циркуляризации (Roche) и отбирали фрагменты. Затем фрагменты были циркулированы Cre Recombinase в соответствии с протоколом Roche для секвенирования 454. Линейную ДНК расщепляли перед фрагментацией кольцевой ДНК. К этим фрагментам лигировали стандартные адаптеры Illumina с парными концами, парные пары (длиной от 180 до 480 п.н.) амплифицировали и секвенировали с обоих концов на платформе Illumina GA II. Библиотеки фосмидов длиной 40 т.п.н. были сконструированы из потомства одной самки в поколении 8 с использованием набора для клонирования парных пар Nx 40 т.п.н. от Lucigen (Миддлтон, США).Фосмидные клоны амплифицировали, фосмидную ДНК экстрагировали целиком, расщепляли с помощью BfaI и отбирали концевые фрагменты размером 8–9 т.п.н. (вектор, включая концы вставок). После рециркуляции и расщепления линейной ДНК пары спаривания амплифицировали с помощью ПЦР и секвенировали на платформе Illumina HiSeq2000. Подробную информацию о размерах библиотек и результатах секвенирования см. в таблице S1.

Фильтрация чтения и обрезка качества.

Все геномные библиотеки были извлечены и преобразованы в формат FASTQ с помощью команд import и convert в береговой версии 0.7.1 [37]. Чтобы удалить дубликаты ПЦР для неслучайного представления фрагментов, каждую библиотеку сканировали с помощью filterPCRdupl . Скрипт pl (версия 1.01), включенный в ConDeTri версии 2.0 [38]. Для библиотек с парными концами сравнивали первые 50 п.н. обоих прочтений пары, а для библиотек парных пар — первые 35 п.н.

Библиотеки парных пар были проверены на наличие следующих последовательностей адаптеров:

5’–TCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACG– 3’

5’–CGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGA– 3’

Скрининг проводился с помощью cutadapt версии 1.1 [39], с частотой ошибок 0,15, перекрытием 6 п.н., минимальной длиной считывания 35 п.н. и соответствующими подстановочными знаками. В результате скрининга было получено два набора сопряженных пар: один набор, содержащий части адаптерных последовательностей, а другой набор без какой-либо адаптерной последовательности. Все остальные библиотеки были отфильтрованы на низкокачественные базы с помощью ConDeTri версии 2.0 (используя параметры по умолчанию для библиотек с парными концами и с параметрами –rmN–hq 20 –minLen 25 для библиотек парных пар).

Оценка размеров библиотечных вставок пары сопряжений.

Чтобы использовать информацию о библиотеке парных пар даже при отсутствии последовательностей адаптеров в считываниях, мы сначала подготовили предварительную сборку. Для этой сборки использовался SOAPdenovo версии 1.05 [40] (размер kmer 27, -d 1, -D 2, -F). В частности, все библиотеки парных концов использовались для построения контигов, но были включены только библиотеки парных пар с последовательностью адаптера; эти прочтения парных пар добавлялись поэтапно в соответствии с размером их вставки (от самого маленького до самого длинного) в течение восьми раундов построения лесов. Чтения сопряженных пар без последовательности адаптера были сопоставлены со сборкой с использованием bwa версии 0.6.1 [41] с параметрами по умолчанию. Пары сопряжений, которые отображались на расстоянии 1 кб друг от друга, были исключены из дальнейших этапов сборки, чтобы предотвратить возможное загрязнение парных концов в данных. Размеры вставок для оставшихся прочтений были оценены для каждой библиотеки на основе расстояний между прочтениями.

Библиотека вставок Fosmid 40 КБ.

Библиотека fosmid размером 40 т.п.н. обрабатывалась несколько иначе, чем библиотеки парных пар. Во-первых, последовательностей phiX были удалены путем сопоставления библиотеки с последовательностью генома phiX с использованием bwa с параметрами по умолчанию.Затем чтения были отфильтрованы на наличие дубликатов ПЦР и оснований низкого качества, аналогично библиотекам парных пар. Наконец, чтения были обрезаны с 3′-конца, чтобы сохранить 50 п.н. на чтение из-за низкого качества чтения к 3′-концу. Размеры вставок отфильтрованных и усеченных прочтений оценивались, как описано выше (с использованием сборки SOAPdenovo).

Сборка генома.

T Окончательная сборка генома была построена с помощью Allpaths-lg версии 43668 [42] с использованием параметров по умолчанию. Из-за этапа коррекции качества в конвейере Allpaths-lg мы использовали библиотеки, отфильтрованные с помощью ПЦР, для библиотек парных концов и парных пар, а также библиотеки фосмидов, отфильтрованные с помощью ПЦР и обработанные по качеству.Для построения контигов использовали библиотеки с перекрывающимися парными концами (размеры вставок 240 и 270 п.н., ID библиотеки 1–5). Библиотеки с более длинными вставками с парными концами (размер вставки 460 п.н., идентификатор библиотеки 6–8), библиотеки сопряженных пар (ID 9–19) и библиотека fosmid (ID 20) были включены в процесс построения каркаса. Allpaths-lg использовали для оценки уровня гетерозиготности эталонного образца генома.

После сборки все чтения парных концов были сопоставлены обратно со сборкой генома с использованием bwa версии 0.6.2, чтобы оценить долю генома, которая не была покрыта считываниями с парными концами. Только очень небольшая часть сборки генома не была покрыта считываниями с парными концами (224 382 п.н. или 0,03%). Кроме того, сборка была проверена на наличие областей прогонов Ns. Эти области возникают во время процесса создания каркаса и означают, что информация о последовательности между двумя контигами может отсутствовать.

Удаление загрязнений.

Чтобы исключить перекрестное загрязнение сборки от других организмов, мы сопоставили окончательную сборку генома с базой данных NCBI nt (blastn, версия 2.2.21, пороговое значение e-значения 10 −5 [43]), сообщая только о лучшем совпадении. Из сборки были исключены скаффолды с ударами только по беспозвоночным организмам. Эта стратегия исключила восемь каркасов общей длиной 27 088 п.н. (0,004% сборки) из окончательной сборки. Кроме того, NCBI провел более строгий скрининг адаптеров, в результате чего из сборки было удалено 1260 п.н. потенциальных последовательностей адаптеров. Визуальный осмотр не выявил каких-либо признаков неправильной сборки в этих местах.

Интеграция генетической карты.

Каркасы были привязаны к группам сцепления с использованием карты генетического сцепления, построенной из 5493 маркеров RAD-seq (подробности о карте сцепления см. в файле S1). Маркеры были сопоставлены с собранным геномом (blastn версии 2.2.27+, значение e < 10 -20 [44]), и только маркеры с уникальными совпадениями использовались для закрепления каркасов с использованием метода, описанного в [1]. Соседние каркасы были разделены строкой символов из 100 Ns. Каркасы, которые не удалось надежно прикрепить к одной из групп сцепления, были сгруппированы в LG Un.

Проверка сборки.

Метки экспрессируемых последовательностей гуппи (EST) были загружены из базы данных EST NCBI (доступ 25 сентября 2013 г.) и взорваны (blastn версия 2.2.27+, значение e < 10 −10 [44]) против предварительная сборка генома. Кроме того, набор из 454 транскриптомных последовательностей [45] был загружен (http://www.bio.fsu.edu/kahughes/Databases.html) и взорван (blastn, e-значение < 10 −10 ) против черновика. последовательность генома. Дополнительные шаги проверки сборки см. в файле S1.

Повтор содержимого.

Библиотека повторов, характерная для гуппи, была создана с использованием проекта сборки генома гуппи и версии RepeatModeler open-1.0.5 [46] в сочетании с ab-blast версии 2.2.6 [47] (параметры по умолчанию используются для обеих программ). Полученная библиотека повторов применялась для выявления и маскирования повторов в черновой сборке с помощью RepeatMasker версии open-3.3.0 [48] с использованием ab-blast в качестве поисковой системы (параметры по умолчанию).

Аннотация набора генов.

Гены были аннотированы с использованием «The NCBI Eukaryotic Genome Annotation Pipeline» (http://www.ncbi.nlm.nih.gov/genome/annotation_euk/process/, по состоянию на 05 сентября 2014 г.). Этот автоматизированный конвейер аннотировал гены, транскрипты и белки в проекте сборки генома (NCBI Poecilia reticulata Annotation Release 100).

Гены с потенциальными функциями в развитии пигментного рисунка, зрения, роста и половой дифференциации.

Чтобы идентифицировать гены, кодирующие белок, с предполагаемыми функциями в развитии пигментного рисунка, зрении, росте и половой дифференциации, был проведен реципрокный поиск бластов с использованием выборки из 624 опубликованных кодирующих последовательностей (таблица S13), в основном относящихся к родственным видам рыб.Полученные пары сегментов с высокой оценкой (HSP) были тщательно проверены вручную на предмет e-значения (<10 -20 ), процентной идентичности (>90%), длины и рамки считывания. Кроме того, предсказанные модели генов из каркасов, локализованных на LG12, были исследованы в базах данных NCBI nt и nr , а также в базах данных Ensembl (версия 71) медаки, колюшки и утконоса. Чтобы определить положение LWS-1 (A180), LWS-2 (P180 и LWS-3 (S180) в кластере на каркасе 43, все экзоны были тщательно изучены на предмет наилучшего значения e (≤ 10 90 144 -40 90 145 ), процент идентичности и кодирующая нить.Кроме того, мы выровняли геномный BAC Cumaná (GenBank HM540108.1) с геномным каркасом 43. Область длиной 32 500 п.н. в реконструированной последовательности BAC соответствует кластеру генов опсина, который был выровнен примерно до 38 300 п.н. на каркасе 43 нашей сборки ( идентичность от 96 до 98%, за исключением нескольких пробелов). Реципрокное выравнивание бластов выявило участки N в сборке Allpaths-lg (до 4500 п.н.) как основную причину несоответствия длины. Мы осмотрели эту область на глаз, но не нашли доказательств, указывающих на неправильную сборку в этой области.Потенциальным объяснением несоответствия длины является неверная оценка размеров вставок библиотек пар сопряжений для этого конкретного региона. Другим возможным объяснением является разница в длине этой конкретной области между штаммами Cumaná и Guanapo.

Малые некодирующие РНК и транспортные РНК (тРНК).

Небольшие локусы некодирующей РНК были аннотированы с использованием Infernal версии 1.1rc1 [49] (порог e-значения 10 -4 ) в сочетании с базой данных Infernal Rfam версии 1.1. Для аннотирования тРНК мы дополнительно запускали программу tRNA-Scan версии 1.3.1 [50].

Выравнивание

Попарные выравнивания/синтетический анализ.

Геном гуппи был выровнен с повторно-маскированными версиями геномов медаки ( Oryzias latipes ) и колюшки ( Gasterosteus aculeatus ) (Ensembl версия 71) с использованием NUCmer версии 3.1 из пакета MUMmer версии 3.23 [51]. Выравнивания визуализировались с помощью Circos plot версии 0.67–7 [52].

Трехстороннее выравнивание.

Аннотации кодирующих последовательностей для гуппи были загружены из GenBank (Accession GCF_000633615.1), а кодирующие последовательности для пецилий ( Xiphophorus maculatus ) и медаки ( Oryzias latipes ) были загружены из Biomart (Ensembl 70). Трехсторонние наборы ортологий 1:1:1 идентифицировали с помощью ProteinOrtho версии 5.11 (настройки параметров: минимальное сходство для дополнительных совпадений 0,8, blastp+). Всего было идентифицировано 10 840 ортологов 1:1:1. Затем последовательности кодонов были выровнены с использованием версии prank 140603 [53] с эмпирической моделью кодонов.

Молекулярно-эволюционный анализ

Оценки коэффициента замещения.

Коэффициенты замены оценивались отдельно для синонимичных ( d S ) и несинонимичных ( d N ) замен 1, звездообразное дерево пользователей, заданное согласно филогении) пакета Paml v4 [54]. Выравнивание с D S S > 2 вдоль любой ветви были исключены для минимизации статистических артефактов из коротких последовательностей и эффектов насыщения в D S (без выравнивания показало, что примерно D N > 2).Окончательный набор данных включал 9111 ортологов 1:1:1 со средними оценками d S 0,052 (±0,033 с.д.), 0,058 (±0,040 с.д.) и 0,949 (±0,262 с.д., guppy) для педиатрической формы. и медака соответственно. Оценки для среднего d N составили 0,008 (± 0,010 sd), 0,008 (± 0,013 sd) и 0,093 (± 0,066 sd) для ветвей пецилии, гуппи и медаки, соответственно.

Оценки частоты мутаций

Было использовано
тройки родителей и потомков.

Мы скрестили самку Quare (лабораторная линия, родом из реки Quare на северо-востоке Тринидада) с самцом EnUlmBL (лабораторная линия, предположительно родом из Венесуэлы). Библиотеки RAD-seq для родителей и пяти особей F 1 были приготовлены с использованием ферментов рестрикции PstI и MseI и 8 уникальных штрих-кодов для каждого родителя и одного уникального штрих-кода для каждой особи F 1 [55]. Библиотеки RAD-seq с приблизительным размером вставки 120–220 п.н. секвенировали с одного конца на дорожке Illumina HiSeq 2000.

Необработанные считывания были получены с платформы секвенирования, преобразованы в формат FASTQ и демультиплексированы с использованием береговой версии 0.8.1. Картирование чтения выполнялось отдельно для каждого человека с помощью версии 2.1.0 Bowtie2 [56]. Результаты картирования были улучшены за счет локальной перестройки с использованием GATK версии 2.4–9 [57]. Детекцию однонуклеотидного полиморфизма (SNP) проводили с использованием GATK UnifiedGenotyper (параметры по умолчанию). Базы высокого качества были извлечены с помощью команды mpileup , реализованной в SAMtools версии 0.1,18 [58] (пороговое значение BAQ 20).

Для обнаружения мутаций de novo вызовы SNP от родителей сравнивали с потомством, используя только сайты, которые были охвачены не менее чем 10 прочтениями. Приблизительно 16 миллионов оснований достигли порога качества оснований, и было обнаружено от 0 до 2 новых мутаций на человека F 1 . Ни одна из мутаций de novo не была обнаружена более чем у одного человека.

Ресеквенирование

Отбор проб и секвенирование.

Десять самцов из популяции с высоким уровнем хищничества, расположенной ниже по течению, были собраны в 2011 г. (PS 77800, Twin Bridges) в бассейне реки Гуанапо на северо-западе Тринидада. Рыб подвергали эвтаназии с помощью MS222 и хранили в 95% этаноле.

Библиотеки секвенирования ДНК с парными концами готовили в соответствии с «Протоколом Illumina для подготовки парных концов»; использование уникальных адаптеров Illumina TruSeq со штрих-кодом для каждого человека. Фрагменты, амплифицированные с помощью ПЦР, отбирали по размеру на 2% геле Low Range Ultra Agarose (Bio-Rad).Библиотеки были объединены и секвенированы на двух дорожках проточных ячеек с помощью прибора Illumina HiSeq 2000 с целью примерно 10-кратного охвата на человека (длина считывания 101 п.н.).

Подготовка данных.

Библиотеки извлечены из платформы секвенирования с помощью команды Shore import версии 0.8.1 для извлечения необработанных данных. Необработанные чтения были преобразованы в файлы fastq с помощью команды Shore convert (см. Таблицу S2 для получения подробной информации о выходе секвенирования на образец).

чтения с парными концами были сопоставлены с эталонным геномом с использованием версии 2.10 Bowtie2 с применением опции картирования «сквозное» (без отсечения чтения) в «очень чувствительном» режиме. Противоречивые выравнивания для парных чтений подавлялись. Сопоставление было улучшено для каждого человека за счет локальной перестройки, реализованной в GATK версии 2.4–9 (RealignerTargetCreator, IndelRealigner), а дубликаты были отмечены с использованием версии Picard 1.89 (http://picard.sourceforge.net, последний доступ 2014-07-09).

SNP звонит.

SNP были вызваны с использованием трех разных вариантов программ вызова: GATK UnifiedGenotyper, freebayes версии 0.9.9 [59] и SAMtools mpileup версии 0.1.18. GATK UnifiedGenotyper и SAMtools mpileup запускались со стандартными параметрами, freebayes — с параметрами «—no-indels—no-mnps—no-complex—use-mapping-quality». SNP, вызванные всеми тремя подходами к вызову SNP (~ 0,7 миллиона), были выбраны в качестве входных данных для повторной калибровки базового качества с набором ковариантов по умолчанию (GATK BaseReICAL).Базовое качество файлов сопоставления было скорректировано с помощью GATK PrintReads, а полученные файлы bam затем использовались в качестве входных данных для второго раунда вызова SNP с помощью GATK UnifiedGenotyper (стандартные параметры). Варианты с аннотацией качества по глубине выше 10,0 (QD>10,0) были выбраны в качестве обучающей выборки для повторной калибровки качества и фильтрации с использованием GATK (~2,1 миллиона). Затем мы провели третий раунд определения вариантов с использованием GATK UnifiedGenotyper. Поскольку не было существенной разницы в количестве (и расположении) SNP между вторым и третьим раундами, SNP третьего раунда использовались в качестве окончательного набора вариантов для последующих анализов.В финальном наборе SNP среднее отношение перехода к трансверсии составило 1,35. Прогнозируемый эффект каждого SNP был аннотирован с использованием SnpEff версии 3.3h [60].

Оценка разнообразия парных нуклеотидов.

Геном разбит на непересекающиеся окна по 50 т.п.н. для каждого скаффолда отдельно. Последнее окно скаффолда не учитывалось, если оно было короче 50 кб. Каркасы упорядочивали и ориентировали вдоль хромосом, как описано выше (см. раздел «Физическая сборка»).Окна с охватом уникальных последовательностей не менее 25 т.п.н. были сохранены для последующих анализов; уникальные последовательности были определены как сайты в каждом окне, которые не были замаскированы ни N, ни повторами. Кроме того, мы требовали, чтобы эти окна были покрыты информацией о последовательности по крайней мере от 7 человек (т.е. порог отсутствующих данных 30%). Для каждого сохраненного окна вычислялось среднее парное разнообразие нуклеотидов (π, 0…1) для неповторяющихся сайтов с использованием вычислений, реализованных в пакете анализа версии 0.8.3 (https://github.com/molpopgen/analysis, последний доступ 11 ноября 2014 г.), найденный в библиотеке libsequence [61] с параметрами по умолчанию.

Демографический вывод.

Чтобы сделать вывод об эффективных размерах популяции ( N e ) истории популяции Гуанапо с высоким уровнем хищничества, была применена скрытая марковская модель (PSMC) на основе коалесцентов, как описано в [62]. Этот метод делает вывод о предках N e с течением времени, используя вероятностную модель слияния, которая объясняет рекомбинацию и изменения в степени гетерозиготности вдоль одного диплоидного генома.Мы запустили PSMC со стандартными параметрами для каждого человека, используя повторно откалиброванные файлы bam (подробности см. Выше) на длинных повторяющихся маскированных каркасах (размер> 10 КБ). Чтобы визуализировать результаты, psmc_plot . Использовали мкл , предполагая частоту мутаций 4,89×10 -8 п.н. на поколение и время генерации 0,5 года [20]. Результаты были нанесены на график от 800 до 25 000 поколений назад, что соответствует от 400 до 12 500 лет до настоящего времени. Нижняя граница была установлена, потому что оценки более поздние, чем 800 поколений, трудно предсказать с помощью метода PSMC [62].

Специфичные для мужчин последовательности

Изменение последовательности и сборка.

Из каждого из 10 самцов, использованных для повторного секвенирования, были извлечены чтения, которые не соответствовали геному самки, с помощью команды просмотра из пакета SAMtools. Чтения от всех людей были объединены вместе, в результате чего было получено 35 миллионов пар чтения. Чтобы снизить вычислительную нагрузку, десять миллионов пар считываний были случайным образом извлечены из этого объединенного набора несопоставленных чтений и собраны с использованием Trinity версии r20140717 [6].Контиги короче 1000 п.н. отбрасывали, и для каждого собранного компонента сохраняли только самую длинную изоформу. Другие ассемблеры (SOAPdenovo, Velvet [63] и ABySS [64]) также тестировались на сборку, специфичную для самцов, но приводили к более высокой фрагментации по сравнению со сборкой Trinity (данные не показаны).

Аннотация.

Мы использовали blastn для сравнения контигов с базами данных env-nt и nt (blastn версии 2.2.30+, значение e < 10 −5 , версия базы данных 20141104) для проверки на загрязнение.Контиги с совпадениями env-nt длиннее 5% от размера контига были удалены. Кроме того, контиги без совпадений с nt были удалены. Оставшиеся контиги были уничтожены против женского генома (blastn, e-значение <10 -10 ), и все контиги с длиной выравнивания, превышающей одну четверть длины контигов, были отброшены. Полученные контиги сравнивали с базой данных nr (blastx, e-value <10 -10 , версия базы данных 20151112).Были сохранены только совпадения с не менее чем 120 аминокислотами охвата целевого белка, 50% идентичностью и значением e < 10 -40 .

Статистический анализ

Если не указано иное, все статистические тесты проводились с использованием R версии 3.1.1 [65]. При необходимости мы использовали поправку Бонферрони для настройки порогов значимости для множественного тестирования.

Депонирование данных

Все краткие данные чтения, созданные в рамках этого проекта, были доступны через Архив кратких чтений NCBI (доступ к исследованию NCBI SRA SRP038017).Номера доступа для геномных библиотек можно найти в таблице S1, а для популяционных образцов — в таблице S2. Номера доступа для образцов, используемых для оценки частоты мутаций: SRR1503964 и SRR1503965 для родителей (самки, мужчины) и SRR1503967-SRR1503971 для пяти F 1 .

Сборка генома была отправлена ​​в NCBI в рамках BioProject PRJNA238429. Весь проект был депонирован в DDBJ/EMBL/GenBank под регистрационным номером AZHG00000000. Версия, описанная в этом документе, — это версия AZHG01000000.Сборка включает группы сцепления с 1 по 23, все неразмещенные последовательности и митохондриальный геном.

Образцы каркаса появляются в строке WGS_SCFLD в нижней части основной записи WGS, AGHG00000000 (CM002706-CM002728 = хромосомы, KK214999-KK218026 = каркасы).

Результаты

Эталонная сборка генома

Чтобы создать эталонный геном гуппи, мы выбрали одну самку и ее потомков женского пола из популяции с высоким уровнем хищничества в стоке Гуанапо.Эта линия была инбредна путем скрещивания братьев и сестер в лаборатории на протяжении пяти поколений, чтобы уменьшить гетерозиготность в геноме. Мы оценили гетерозиготность примерно в 1 SNP на 400 п.н. у индивидуума, использованного для парного секвенирования концевого генома. Мы использовали потомство этой самки из более поздних поколений для создания ряда библиотек Illumina с размерами вставок до 40 КБ и сгенерировали примерно 225 ГБ необработанных данных (дополнительную информацию о библиотеках и размерах вставок см. в таблице S1).После удаления дубликатов ПЦР осталось около 148 Гб данных последовательности, которые мы собрали в 3028 скаффолдов общей длиной 732 Мб. Самый длинный скаффолд (скаффолд 0) имеет длину более 21 Мб. Половина сборки представлена ​​43 каркасами длиной не менее 5,3 Мб (N50), а 90% сборки — 163 каркасами размером более 1 Мб (N90; см. Таблицу 1 для получения дополнительной информации о сборке). Размер сборки находится в пределах предыдущих оценок от 740 до 900 Мб для генома гуппи [66], при 2 n = 46 хромосом [32, 34].Подход к частоте k-mer оценил размер генома женского генома в 779,8 Мб (файл S1), что лишь немного больше, чем собранный геном.

Чтобы оценить полноту сборки, мы сопоставили метки экспрессируемых последовательностей (EST) [65] и транскриптом Roche 454 [45] других штаммов гуппи с нашим вновь сконструированным эталоном. Большинство как EST (15 579/16 220; 96,0%), так и 454 контига (50 188/54 981; 91,28%) могут быть расположены на сборке генома.

Гены зрительного пигмента (опсины) подробно описаны у гуппи [67–71]; поэтому мы искали в нашей сборке генома эти локусы в качестве дополнительной проверки полноты сборки.Используя опубликованные кДНК опсина и геномные последовательности гуппи [67, 68, 70] и близкородственных видов пецилиевых [69], мы подтвердили наличие генов родопсина и девяти колбочковых опсинов (таблица S3). Семь находятся в двух кластерах на LG5, один включает чувствительные к зеленому Rh3-1 и Rh3-2, а другой включает чувствительные к синему гены SWS2A и SWS2B и три чувствительных к красному/оранжевому цвету гена LWS. Четвертый ретротранспонированный ген LWS-4 находится на LG2, а ген, кодирующий чувствительный к УФ-излучению SWS-1, находится на неразмещенном каркасе (LG Un).Эти результаты подтвердили высокое качество нашей сборки.

Основываясь на сравнении тегов RAD-seq у родителей и их потомства F 1 , мы рассчитали частоту мутаций 4,9 x 10 90 144 -8 90 145 п.н. 90 144 -1 90 145 поколения 90 144 -1 90 145 . Это находится в том же диапазоне, что и для цихлид Midas, у которых предполагаемая частота мутаций составляет 6,6 x 10 90 144 -8 90 145 п.н. 90 144 -1 90 145 поколений 90 144 -1 90 145 [72]. Таким образом, наша сборка также должна быть полезна для обнаружения мутаций de novo , которые могут способствовать локальной адаптации в дополнение к изменчивости положения.

Аннотация генома

Всего было предсказано 22 982 кодирующих белок гена и 249 псевдогенов. Кроме того, мы аннотировали 439 генов тРНК для 20 стандартных аминокислот, 707 локусов микроРНК и 160 локусов мяРНК (таблица S4).

Повторяющиеся последовательности составляют примерно 20% (156 Мб) сборки (дополнительные сведения см. в таблице S5). Учитывая трудности сборки высоко повторяющихся центромерных областей, они могут быть недопредставлены. Среднее содержание GC в геноме составляет 39.3%, без явных признаков изохорной организации вдоль 23 хромосом (рис. 2), хотя некоторые хромосомы демонстрируют слегка повышенное содержание GC ближе к концам групп сцепления.

Рис. 2. Характеристики последовательности для каждой группы сцепления.

Связные группы указаны снаружи. Маленькие цифры указывают расстояния вдоль каждой группы сцепления в Мб. Оценки нуклеотидного разнообразия, π, содержания GC, а также генной (экзоны и интроны) и плотности повторов усредняются в окнах размером 50 т.п.о.Обратите внимание, что повторы могут быть расположены в генных регионах.

https://doi.org/10.1371/journal.pone.0169087.g002

Synteny с геномами других рыб

Используя карту сцепления с высокой плотностью, содержащую 5493 маркера, более 95% сборки можно закрепить на 23 группах сцепления (LG), что соответствует гаплоидному набору гуппи из 23 хромосом. Предполагаемые размеры хромосом колеблются от 18 до 46 Мб (рис. 2 и 3, таблица S6). Самая длинная хромосома, LG2, является продуктом слияния предковых хромосом, которые соответствуют хромосомам 2 и 21 медаки ( Oryzias latipes ), и группам II и XVI колюшки ( Gasterosteus aculeatus ) (рис. 4, S1 рис. ).Почти все сцепленные скаффолды могли быть ориентированы, так как содержали как минимум два генетических маркера с событиями рекомбинации между ними (рис. 3). Выравнивание геномов гуппи и медаки подтвердило обширную синтению (рис. 4), как это было ранее установлено путем сопоставления гомологов генетических маркеров гуппи с геномом медаки [30].

Рис. 3. Распределение анкерных лесов по группам навески.

Серые прямоугольники обозначают каркасы с минимум двумя маркерами. Каркасы в прямой ориентации окрашены сплошным серым цветом, а в обратной ориентации — светло-серым пунктиром.Черные прямоугольники с контуром и горизонтальные черные полосы обозначают каркасы только с одним маркером и неизвестной ориентацией. Расстояние между каркасами было установлено произвольно в 500 kb.

https://doi.org/10.1371/journal.pone.0169087.g003

Рис. 4. Выравнивание всего генома между Гуппи и Медакой.

Circos график синтетических отношений между хромосомами гуппи (слева) и медака (справа). Минимальная длина блока 500 п.н. Светло-серые линии указывают на несинтенические блоки выравнивания или блоки, не относящиеся к какой-либо группе сцепления гуппи (UN).

https://doi.org/10.1371/journal.pone.0169087.g004

Половые хромосомы

LG 12 соответствует Х-хромосоме, и генетическая карта позволила отнести к этой хромосоме 26,4 Мб собранной последовательности (рис. 3, таблица S6). Полное выравнивание генома выявило синтению гуппи LG12 к хромосоме 12 медаки и группе XIV колюшки (рис. S1B и S1C). Содержание генов и повторов существенно не различается между Х-хромосомой и аутосомами (таблица 2), и общее содержание GC также очень похоже (39.0% против . 39,4%). Скорость эволюции кодирования белка, оцененная по соотношению несинонимичных и синонимичных замен, d N /d S , существенно не отличается в ветви гуппи между Х-хромосомой и аутосомой. (критерий Манна-Уитни U , р = 0,0677; рис. 5, табл. 2), но среднее внутривидовое попарное нуклеотидное разнообразие ( π ), определенное при повторном секвенировании 10 самцов популяции гуанапо, значительно выше на Х-хромосома (p < 0.001; Таблица 2).

Рис. 5. Скорость эволюции вдоль Х-хромосомы (LG12) и аутосом.

Графики плотности (А) долей несинонимичных ( d N ), (В) синонимичных замен на нуклеотид ( d S ) отношения 05 N

9 и
D
8
S
9 (
D
8
N / D / D S ) Между LG12 (красные пунктирные линии) и автосом (черные пунктирные линии).

https://doi.org/10.1371/journal.pone.0169087.g005

Таблица 2. Характеристики аутосом и Х-хромосомы (LG12).

Оценки взяты из окон размером 50 КБ в каждой связанной группе. Измерения D N (скорость ненонимальных замен на несинониму), D S (скорость синонимичных замен на синонимный сайт) и соотношение D N / D S (средние оценки аппроксимируются Σd N / Σd S ), π (разнообразие нуклеотида в пределах населения).Покрытие было оценено с использованием объединенных данных повторного секвенирования и показано как среднее покрытие на базу. Статистическую проверку проводили с использованием непараметрического критерия Манна-Уитни U (н.с., недостоверно, ***, p < 0,001).

https://doi.org/10.1371/journal.pone.0169087.t002

Многочисленные доказательства указывают на то, что X- и Y-хромосомы содержат гены мужского размера и цвета (см. Введение), включая предыдущее исследование QTL, которое использовали около 800 SNP-маркеров [30].Поэтому мы более подробно изучили регионы QTL. Из трех маркеров на проксимальном конце LG12, объясняющих различия в размерах самцов [30], мы локализовали два, маркер-30 и маркер-61, на каркасе 10 в положениях 6,071,651 и 6,634,572. Эта область (6,0–6,7 Мб) содержит два гена, кодирующие белки, связанные с ростом, белок 7, подобный эпидермальному фактору роста ( egf17 ) [73], и белок, подобный белку 1, специфичному для остановки роста ( GAS1 ) [74]. ], (Таблица S7). Из бластных поисков с использованием известных генов-кандидатов в качестве запросов, а также выравнивания всех каркасов LG12 с общедоступными базами данных мы нашли еще шесть кандидатов для роста по этой хромосоме (таблица S7).Tripathi и коллеги [30] также обнаружили маркеры на LG12, объясняющие изменение цвета [30]; мы смогли найти три из них, marker_691, marker_423 и marker_210, на каркасе 13 в позициях 4 566 793, 5 622 647 и 7 057 973. В пределах этой области (4,6–7,1 Мб) мы идентифицировали одного возможного кандидата в гены окраски, mlana [75]. Дополнительные взаимные бластные поиски выявили четыре других кандидата в гены окраски, распределенные по всему LG12: Solute Carrier Family 45 Member A2 ( slc45a2 , aim1 ) [76], Superkiller Viralicide Activity 2-Like 2 ( skiv2l2 ) [77], препромеланин концентрирующий гормон ( pro-MCH-подобный ) [78] и сепиаптеринредуктаза ( spra ) [79] (таблица S7).

Tripathi и коллеги [30] картировали локус, определяющий пол, в самой дистальной позиции LG12, области, возможно, не включенной в сборку нашего женского генома. Следует отметить, что три гена связаны с половой дифференциацией у рыб ( parm1 [80], 5-гидрокситриптаминовый рецептор 1A-бета-подобный [81] и gadd45gamma [82]), а один — с сцепленным с полом поведением ( 5ht рецептор 1a [81]) были обнаружены в пределах 120 т.п.н. друг от друга на одном из коротких дистальных каркасов (скаффолд 185; S7 Table).

Чтения от 10 самцов гуанапо, выловленных в дикой природе (подробности об этих особях приведены в следующем подразделе и в разделе «Методы»), которые не могли быть сопоставлены с эталонным геномом самок, были собраны отдельно. Это привело к 1462 контигам длиной от 1 до 7,5 т.п.н. (в среднем 1,6 т.п.о.), что в сумме составило до 2,3 млн. п.н. последовательности, которая потенциально представляет специфичные для мужчин области из Y-подобной дифференцированной части половых хромосом. Эти последовательности включают 72 гена, кодирующих белок, с предполагаемой функцией и 34 без нее, каждая из которых покрывает не менее 40% гомологов в базе данных nr (таблица S8).

Ресеквенирование населения

Чтобы исследовать разнообразие последовательностей в популяции гуанапо, источнике штамма, используемого для сборки генома, мы повторно секвенировали 10 самцов, пойманных в дикой природе, со средним охватом 12x на особь (от 8,5x до 14,0x). Сопоставление мужских прочтений с женским эталонным геномом выявило почти 5 миллионов однонуклеотидных полиморфизмов (SNP). Около 80% SNP были обнаружены как минимум в двух аллелях (таблица S9). В среднем на человека было идентифицировано чуть более 2 миллионов SNP, а среднее соотношение гетерозиготных и гомозиготных SNP равнялось 1.76 (±0,16, медиана 1,74; таблица S10). 10% SNP были расположены в кодирующих областях, с 173 485 несинонимичными заменами и 2520 бессмысленными изменениями по сравнению с эталоном (таблица S11). Среднее парное разнообразие нуклеотидов ( π ) составляло 0,0025 (± 0,0013, медиана 0,0024) с очень однородным распределением по всему геному и ограниченными внутрихромосомными вариациями вдоль LG2, LG5, LG8, LG16 и LG18 (рис. 2). Проверка распределения самого верхнего 1% оценок π окон ( π > 0.009) также не показал пространственной кластеризации вдоль хромосом (критерий Колмогорова-Смирнова D = 0,2145, p = 0,2324).

Нуклеотидный состав

(измеренный как содержание GC, усредненное по окнам размером 50 т.п.н.) слабо отрицательно коррелировал с π (⍴ Спирмена = -0,0216, p = 0,0299). Дальнейшее изучение этой корреляции показало, что для низкого и среднего (35%-41%) содержания GC корреляция была отрицательной, тогда как для более высокого содержания GC (>41%) корреляция показала положительную тенденцию (S2 Fig).Мы не обнаружили корреляции между π и количеством генных сайтов в окне (⍴ = -0,0146, p = 0,1419), но была небольшая отрицательная корреляция между π и содержанием повторов (⍴ = -0,0295, p = 0,0030). .

Историческая демография повторно секвенированных лиц была исследована с использованием скрытой марковской модели на основе слияния [62] для каждого из повторно секвенированных лиц. Эффективная популяция предков ( N e ) была оценена как самая высокая около трех-четырех тысяч лет назад ( N e ~ 10 000) и с тех пор снижалась с довольно постоянной скоростью. (Рис. 6).Чтобы проверить наблюдаемую закономерность, мы запустили анализ. Результаты бутстрэпа (50 бутстрэпов) подтвердили демографическую историю популяции гуппи гуанапо с высоким уровнем хищничества (показаны только для особей Gh23, см. рис. 7).

Рис. 6. Вывод об изменении размера популяции с течением времени.

Результаты PSMC для популяции с высоким уровнем хищничества для каждой особи. Каждый цвет представляет одного человека. Шкала времени по оси абсцисс рассчитана при частоте мутаций 4,89×10 90 144 -8 90 145 п.н. 90 144 -1 90 145 поколений 90 144 -1 90 145 и времени генерации 0.5 лет.

https://doi.org/10.1371/journal.pone.0169087.g006

Рис. 7. Вывод об изменении размера популяции с течением времени.

Графики результатов бутстрапирования PSMC для отдельных особей, представляющих популяцию с высоким уровнем хищничества (Gh23). Сплошная красная линия изображает среднюю оценку, светло-красные линии — результаты 50 бутстрапов. Шкала времени по оси абсцисс рассчитана при частоте мутаций 4,89×10 90 144 -8 90 145 п.н. 90 144 -1 90 145 поколений 90 144 -1 90 145 и времени генерации 0.5 лет.

https://doi.org/10.1371/journal.pone.0169087.g007

Обсуждение

Здесь мы представляем собранный высококачественный эталонный геном эволюционной и экологической модельной системы тринидадской гуппи. Общий размер сборки составляет примерно 732 Мб, что близко к предсказанному размеру генома от 740 до 900 Мб, полученному по данным проточной цитометрии и денситометрии с окрашиванием по Фельгену [66]. Сборка очень непрерывна по сравнению с другими опубликованными геномами костистых рыб (таблица S12), причем половина сборки представлена ​​43 каркасами, которых как минимум 5.3 Мб. Мы добились высокого качества сборки, хотя инбридинг был относительно ограничен. Для сравнения, более 100 поколений инбридинга предшествовали усилиям по созданию полной сборки генома для Xiphophorus maculatus , другого вида из того же семейства, что и гуппи [83]. Используя карту сцепления высокой плотности, мы сориентировали 219 каркасов (94% собранного генома) вдоль 23 хромосом. Мы обнаружили большое количество синтении у медаки и колюшки и подтвердили, что LG2 является результатом слияния двух предковых хромосом [30], что еще раз подтвердило высокую степень стабильности кариотипов у перкоморфных рыб (e.грамм. [83]). Мы также полностью собрали митохондриальный геном (дополнительный текст, рис. S3), который можно использовать для лучшего понимания филогенетических взаимоотношений между отдаленно родственными рыбами [84]. В совокупности эталонный женский геном значительно расширяет молекулярные ресурсы, разработанные для этой системы [45, 85–87]. Новая эталонная сборка уже помогла определить молекулярную основу цветовых мутаций [86] и предоставила информацию для сравнения естественных и экспериментальных популяций [88].

Эталонный геном гуппи поможет раскрыть генетическую основу адаптивных фенотипов гуппи. Предыдущий анализ QTL предоставил предварительные доказательства того, что несколько локусов, отвечающих за размер и окраску самцов, расположены на половой хромосоме, причем локус, определяющий пол, расположен на самом дистальном конце [30]. После закрепления этих маркеров в собранном геноме мы искали гены-кандидаты в их окрестностях и идентифицировали несколько генов с известными функциями в пигментации, росте и определении пола в других таксонах (см. Таблицу S7 для ссылок).Аналогичным образом, несколько исследовательских групп, интересующихся взаимосвязью между выбором самки и специфичной для самцов окраской, попытались охарактеризовать набор генов зрительного пигмента (опсин) гуппи, уделяя особое внимание многочисленным и разнообразным генам LWS, но результаты различались в разных исследованиях ( например, в зависимости от того, скринировали ли геномную ДНК гуппи или РНК глаза) [70, 89, 90]. Наши результаты подтверждают объединенные результаты этих предыдущих исследований, идентифицируя четыре опсина LWS, два опсина Rh3, два опсина SWS2, один опсин SWS1 и один опсин Rh2.Сравнение этой сборки генома гуппи гуанапо с предыдущим геномным гуппи Кумана результаты секвенирования BAC совпадают по количеству копий LWS и расположению, включая ретротранспонированный LWS4 в гене геферина. Уотсон и др. . [68] ранее сравнили геномную структуру всех генов LWS между гуппи Cumana и Xiphophorus helleri с помощью геномного ВАС-секвенирования и пришли к выводу, что расположение кластера LWS, а также событие ретротранспозиции LWS-4 произошло до разделения между Xiphophorus. и клад Poecilia [68, 69].

Нас особенно интересует эволюция половых хромосом, LG12, из-за их известных вариаций, лежащих в основе признаков, важных для местной адаптации, таких как цвет и размер самцов. Предполагается, что половые хромосомы будут развиваться иначе, чем аутосомы, из-за их различий в передаче и плоидности, а также в результате различий в эффективном размере популяции [91]. Однако мы не нашли доказательств повышенной скорости эволюции Х-хромосомы у гуппи. Это может быть связано с тем, что большая часть собранной хромосомы является псевдоаутосомной и свободно рекомбинирует с Y-хромосомой, в то время как диверсифицированная дифференцированная дистальная область может все еще отсутствовать в сборке.Более того, детерминация пола является быстро развивающимся признаком у рыб, включая пецилиевых, и в оценках скорости эволюции с использованием медаки и плати в качестве внешних групп почти наверняка преобладают периоды времени, когда последовательности LG12 были аутосомными. Внутривидовое разнообразие нуклеотидов было выше на Х-хромосоме, чем на аутосомах, что предполагает, что молекулярные эволюционные различия между половыми хромосомами гуппи и аутосомами действительно проявляются в более коротких временных масштабах.

Поскольку мы не можем сказать, существует ли женский аналог дифференцированной области Y-хромосомы у самок, мы отдельно собрали считывания из десяти мужских образцов и идентифицировали контиги, которые не отображались на женской эталонной сборке.Хотя мы собрали тысячу таких контигов, ни один из них не содержал явных кандидатов на детерминацию пола, пигментацию или рост. Эти только мужские контиги были короткими по длине (самый длинный чуть более 7 т.п.н.) и содержали много усеченных открытых рамок считывания, что может быть связано с неполной сборкой или с тем, что они подверглись псевдогенизации. Предполагается, что отсутствие рекомбинации в Y-хромосомах снижает естественный отбор в этой области и, в свою очередь, увеличивает скорость псевдогенизации, потери генов и повторной экспансии [92, 93].Третья альтернатива заключается в том, что последовательности в основном являются общими для X и Y, причем последовательности, специфичные для самцов, вкраплены между общими последовательностями, а не длинные блоки последовательностей, специфичных для самцов.

Мы уже использовали эталонную сборку для исследования генетического разнообразия в реке Гуанапо, районе с высоким уровнем хищничества на северо-западе Тринидада, который был исходной популяцией для наших эталонных штаммов. Разнообразие было довольно однородным по всему геному и не сильно коррелировало с другими геномными особенностями, такими как GC или генный контент.Охват может быть еще одним потенциальным смешанным фактором в отношении разнообразия попарных нуклеотидов. Мы обнаружили, что при более высоком охвате вызывалось немного меньшее количество альтернативных аллелей (⍴ = -0,1147, p <0,001, рис. S4), но корреляция не была линейной и существенно не меняла пропорцию вызываемых альтернативных аллелей между регионами с разным охватом. В то время как корреляция оказалась положительной для регионов с более низким охватом (70x-130x), она была отрицательной для регионов с более высоким охватом (130x-300x).

Используя попарно-последовательную марковскую коалесцентную модель [62], которая использует локальную плотность гетерозиготных сайтов в отдельных диплоидах, мы оценили, что наша исходная популяция имеет большой текущий эффективный размер популяции (~ 2500). Это было сравнимо с другими оценками эффективных размеров популяции с высоким уровнем хищничества, оцененными по той же реке (~ 1300 [16]) и других популяций с высоким уровнем хищничества в низинах (~ 2000–14 000 [88], ~ 700–4200 [16]). . Оценки N e росли с увеличением возраста слияния, что ожидается, если популяция хорошо связана через поток генов с более крупной метапопуляцией.Эта обширная генетическая изменчивость, обнаруженная в низменных популяциях, может быть основным фактором быстрой и повторяемой адаптации колонизаторов к новым режимам хищничества, наблюдаемым в более высоких местах [19, 20].

Наша эталонная сборка представляет собой важный шаг в предоставлении столь необходимого ресурса для изучения эволюционной генетики гуппи. Будущие исследования могут использовать нашу эталонную сборку и исследовать многие аспекты биологии гуппи, которые делают ее модельной системой для понимания эволюционной биологии и экологии, включая эволюцию истории жизни, материнское обеспечение и успех вторжения.Однако ограничения нашей эталонной сборки, основанной на коротком прочтении, также подчеркивают, что для выявления полной последовательности половых хромосом у этого вида необходимы новые подходы к секвенированию и сборке генома.

Вспомогательная информация

S1 Рис. Выравнивание полного генома между гуппи и колюшкой.

(A) График Circos, показывающий синтетическую связь между группами сцепления гуппи 1–23 и UN для неназначенных каркасов и хромосом I-XXI колюшки. (B) График Circos, на котором показаны выравнивания между хромосомами гуппи LG2 (слева) и медака. (C) Диаграмма Circos для выравнивания между выбранными регионами гуппи (LG2 и LG12) и колюшки. Каждая строка представляет собой блок выравнивания размером не менее 500 п.н.

https://doi.org/10.1371/journal.pone.0169087.s001

(PDF)

S2 Рис. Нуклеотидный состав (GC-содержание) в корреляции со средним разнообразием нуклеотидов (

π ). Содержание

GC и π оценивалось по окнам размером 50 кб.Оранжевая линия представляет регрессию LOWESS; пунктирные линии обозначают среднее содержание GC и среднее значение π соответственно.

https://doi.org/10.1371/journal.pone.0169087.s002

(PDF)

S3 Рис. Митохондриальный геном гуппи.

Circos участок аннотации митохондриального генома. Крайняя окружность обозначает гены и рРНК/тРНК, транскрибированные с ведущей цепи, а вторая крайняя окружность — с отстающей цепи. Самый внутренний круг представляет собой содержание GC на каждые 5 п.н.; чем темнее линии, тем выше содержание GC.

https://doi.org/10.1371/journal.pone.0169087.s003

(PDF)

S4 Рис. Покрытие в корреляции с долей названных аллелей.

Среднее покрытие оценивалось по окнам размером 50 КБ. Было подсчитано количество эталонных и нереференсных сайтов на SNP, и была оценена пропорция на окно размером 50 т.п.н. для эталонного аллеля (доля референсного аллеля) и для нереференсного аллеля (доля альтернативного аллеля). Оранжевая линия представляет регрессию LOWESS; вертикальная пунктирная линия обозначает средний охват.

https://doi.org/10.1371/journal.pone.0169087.s004

(PDF)

S1 Таблица. Обзор данных секвенирования, использованных для сборки генома самки гуппи.

Необработанные данные обозначают выход секвенирования после удаления phiX , а отфильтрованные данные обозначают данные секвенирования после удаления дубликатов ПЦР. PE = библиотека парных концов, MP = библиотека пар сопряжений, FM = библиотека Fosmid.

https://doi.org/10.1371/journal.pone.0169087.s005

(PDF)

S2 Таблица.Обзор данных секвенирования, используемых для повторного секвенирования населения и населения.

Результат секвенирования особей популяции с высоким уровнем хищничества. Столбец «Сопоставление прочтений со ссылкой» относится к проценту прочтений, сопоставленных с женским геномом. Столбец «Непокрытые в Mb» относится к непокрытым последовательностям в Mb после сопоставления геномных библиотек с парными концами с эталонным геномом.

https://doi.org/10.1371/journal.pone.0169087.s006

(PDF)

Благодарности

Благодарим Д.Резник за рыбу-основателя из Гуанапо, Э. Руэлл и К. Галамбор за образцы популяции, А. Фернесс за помощь в выборе участков для отбора проб, С. Топуз за уход за рыбами, М. Зайдем за помощь в измерении скорости мутаций, К. Ланцу за помощь в секвенировании, К. Драйшеру за обновление генетической карты и совместное использование сценариев, С. Хенцу за предоставление сценариев и Р. Бурри, А. Нолте, Л. Смедсу, П. И. Оласону, Д. Кенигу, Р. Нееру и Ф. Занини для обсуждения. Мы благодарны двум анонимным рецензентам, чьи комментарии помогли улучшить рукопись.

Вклад авторов

  1. Концептуализация: CD.
  2. Контроль данных: АК.
  3. Формальный анализ: AK, BAF, ES.
  4. Финансирование приобретения: DW.
  5. Расследование: АК, БАФ.
  6. Методология: АК.
  7. Администрация проекта: CD.
  8. Ресурсы: БАФ, ВАК, МЗ.
  9. Программное обеспечение: АК.
  10. Надзор: CD, DW.
  11. Валидация: AK.
  12. Визуализация: АК.
  13. Письмо – первоначальный вариант: AK, BAF, DW, CD.
  14. Написание – рецензирование и редактирование: AK, BAF, DW, CD.

Каталожные номера

  1. 1. Эллегрен Х., Смедс Л., Бурри Р., Оласон П.И., Бакстрем Н., Каваками Т. и др. Геномный ландшафт дивергенции видов у мухоловок Ficedula.Природа. 2012;491(7426):756–60. пмид:23103876
  2. 2. Brawand D, Wagner CE, Li YI, Malinsky M, Keller I, Fan S, et al. Геномный субстрат адаптивной радиации у африканских цихлид. Природа. 2014.
  3. 3. Бурри Р., Натер А., Каваками Т., Мугал С.Ф., Оласон П.И., Смедс Л. и др. Связанный отбор и изменение скорости рекомбинации определяют эволюцию геномного ландшафта дифференциации в континууме видообразования мухоловок Ficedula. Геном Res.2015.
  4. 4. Сориа-Карраско В., Гомперт З., Комо А.А., Фаркас Т.Е., Парчман Т.Л., Джонстон Дж.С. и соавт. Геномы палочников раскрывают роль естественного отбора в параллельном видообразовании. Наука. 2014;344(6185):738–42. пмид:24833390
  5. 5. Renaut S, Grassa CJ, Yeaman S, Moyers BT, Lai Z, Kane NC, et al. Геномные острова дивергенции не зависят от географии видообразования подсолнечника. Нац коммун. 2013; 4:1827. пмид:23652015
  6. 6. Grabherr MG, Haas BJ, Yassour M, Levin JZ, Thompson DA, Amit I, et al.Сборка полноразмерного транскриптома из данных RNA-Seq без эталонного генома. Природная биотехнология. 2011;29(7):644–52. пмид:21572440
  7. 7. Hohenlohe PA, Bassham S, Etter PD, Stiffler N, Johnson EA, Cresko WA. Популяционная геномика параллельной адаптации трехиглой колюшки с использованием секвенированных меток RAD. Генетика PLoS. 2010;6(2):e1000862–. пмид:20195501
  8. 8. Поп М., Зальцберг С.Л. Биоинформатические проблемы новой технологии секвенирования. Тенденции в генетике: TIG.2008;24(3):142–9. Центральный PMCID PubMed: PMCPMC2680276. пмид:18262676
  9. 9. Гэблдон Т, Кунин ЕВ. Функциональные и эволюционные последствия ортологии генов. Нат Рев Жене. 2013;14(5):360–6. пмид:23552219
  10. 10. Иннан Х., Кондрашов Ф. Эволюция дупликаций генов: классификация и различие между моделями. Нат Рев Жене. 2010;11(2):97–108. пмид:20051986
  11. 11. Постлетвейт Дж., Аморес А., Креско В., Сингер А., Ян Ю.Л. Разделение подфункций, излучение костистых костей и аннотация генома человека.Тенденции в генетике: TIG. 2004;20(10):481–90. пмид:15363902
  12. 12. Брааш И., Петерсон С.М., Десвин Т., МакКласки Б.М., Батзел П., Постлетвейт Дж.Х. Армия новых моделей: Новые модели рыб для изучения геномики позвоночных Evo-Devo. J Exp Zool B Mol Dev Evol. 2015;324(4):316–41. Центральный PMCID PubMed: PMCPMC4324401. пмид:25111899
  13. 13. Винге О. Одностороннее мужское и сцепленное с полом наследование у Lebistes reticulatus. Журнал генетики. 1922; 12: 146–62.
  14. 14.Эндлер Дж.А. Коэволюция множественных признаков и градиенты окружающей среды у гуппи. Тенденции Экол Эвол. 1995;10(1):22–9. Эпб 1995/01/01. пмид:21236940
  15. 15. Магурран АЕ. Эволюционная экология: тринидадская гуппи: издательство Оксфордского университета; 2005 25 авг. 206 с.
  16. 16. Барсон Н.Дж., Кейбл Дж., Ван Остерхаут С. Популяционный генетический анализ микросателлитной вариации гуппи (Poecilia reticulata) в Тринидаде и Тобаго: доказательства динамической структуры метапопуляции источник-приемник, события-основатели и узкие места популяции.Дж. Эвол Биол. 2009;22(3):485–97. пмид:19210594
  17. 17. Александр Х.Дж., Тейлор Дж.С., Ву С.С., Бреден Ф. Параллельная эволюция и викариантность гуппи (Poecilia reticulata) в различных пространственных и временных масштабах. Эволюция. 2006;60(11):2352–69. пмид:17236426
  18. 18. Эндлер Дж.А. Естественный отбор по окраске Poecilia reticulata. Эволюция. 1980; 34: 76–91.
  19. 19. Гордон С.П., Резник Д., Арендт Д.Д., Роутон А., Онтиверос Эрнандес М.Н., Бенцен П. и др.Селекционный анализ быстрой эволюции вторичного полового признака. Proc Biol Sci. 2015;282(1813):20151244. пмид:262
  20. 20. Резник Д.Н., Шоу Ф.Х., Родд Ф.Х., Шоу Р.Г. Оценка скорости эволюции природных популяций гуппи (Poecilia reticulata). Наука. 1997; 275 (5308): 1934–1937. Эпб 1997/03/28. пмид:

    71

  21. 21. Резник ДН. Эволюция жизненного цикла гуппи (Poecilia reticulata): 1. Фенотипические и генетические изменения в интродукционном опыте.Эволюция (Нью-Йорк). 1987; 41: 1370–85.
  22. 22. Резник Д.Н., Галамбор К.К., Крукс К. Экспериментальные исследования эволюции гуппи: модель для понимания эволюционных последствий удаления хищников в естественных сообществах. Мол Экол. 2008;17(1):97–107. Эпб 30.08.2007. пмид:17725576
  23. 23. Барретт Р.Д., Шлютер Д. Адаптация к постоянной генетической изменчивости. Тенденции Экол Эвол. 2008;23(1):38–44. пмид:18006185
  24. 24. Olendorf R, Rodd FH, Punzalan D, Houde AE, Hurt C, Reznick DN, et al.Зависимая от частоты выживаемость в естественных популяциях гуппи. Природа. 2006;441(7093):633–6. пмид:16738659
  25. 25. Хьюз К.А., Худ А.Е., Прайс А.С., Родд Ф.Х. Преимущество спаривания для редких самцов в диких популяциях гуппи. Природа. 2013: 1–10.
  26. 26. Линдхольм А., Бреден Ф. Половые хромосомы и половой отбор у пецилий. Я Нат. 2002; 160 Приложение 6: S214–24. Эпб 19.08.2008.
  27. 27. Брукс Р., Эндлер Дж.А. Прямой и непрямой половой отбор и количественная генетика признаков самцов гуппи (Poecilia reticulata).Эволюция. 2001;55(5):1002–15. пмид:11430637
  28. 28. Худ АЕ. Выбор пола, цвета и партнера у гуппи: издательство Принстонского университета; 1997. 210 с.
  29. 29. Хьюз К.А., Родд Ф.Х., Резник Д.Н. Генетические и экологические эффекты на вторичные половые признаки у гуппи (Poecilia reticulata). Дж. Эвол Биол. 2005;18(1):35–45. пмид:15669959
  30. 30. Трипати Н., Хоффманн М., Уиллинг Э.М., Ланц С., Вайгель Д., Дрейер С. Карта генетического сцепления гуппи, Poecilia reticulata и количественный анализ локусов признаков размера и окраски самцов.Труды Королевского общества B: Биологические науки. 2009; 276 (1665): 2195–208. Центральный PMCID PubMed: PMCPMC2677598. пмид:19324769
  31. 31. Чарльзуорт Д., Чарльзуорт Б., Марэ Г. Этапы эволюции гетероморфных половых хромосом. Наследственность (Эдинб). 2005;95(2):118–28.
  32. 32. Нанда И., Шориес С., Трипати Н., Дрейер С., Хааф Т., Шмид М. и др. Полиморфизм половых хромосом у гуппи. Хромосома. 2014.
  33. 33. Лисачев А.П., Задесенец К.С., Рубцов Н.Б., Бородин П.М.Синапсис половых хромосом и рекомбинация у самцов гуппи. данио. 2015;12(2):174–80. пмид:25608108
  34. 34. Траут В., Уинкинг Х. Мейотические хромосомы и этапы эволюции половых хромосом у рыб: рыбок данио, утконосов и гуппи. Хромосомный Рез. 2001;9(8):659–72. пмид:11778689
  35. 35. Tripathi N, Hoffmann M, Weigel D, Dreyer C. Анализ сцепления показывает независимое происхождение половых хромосом Poeciliid и случай атипичного наследования пола у гуппи (Poecilia reticulata).Генетика. 2009;182(1):365–74. Центральный PMCID PubMed: PMCPMC2674833. пмид:19299341
  36. 36. Bolger A, Scossa F, Bolger ME, Lanz C, Maumus F, Tohge T, et al. Геном стрессоустойчивых видов диких томатов Solanum pennellii. Нат Жене. 2014: 1–6.
  37. 37. Ossowski S, Schneeberger K, Clark RM, Lanz C, Warthmann N, Weigel D. Секвенирование природных штаммов Arabidopsis thaliana с помощью коротких ридов. Геном Res. 2008:гр.080200.108-.
  38. 38. Смедс Л., Кюнстнер А.CONDETRI — триммер чтения, зависящий от содержимого, для данных Illumina. ПЛОС ОДИН. 2011;6(10):e26314. пмид:22039460
  39. 39. Martin M. Cutadapt удаляет последовательности адаптеров из операций высокопроизводительного секвенирования. EMBnetjournal. 2011;17(1):стр. 10–2.
  40. 40. Li R, Zhu H, Ruan J, Qian W, Fang X, Shi Z и др. Сборка геномов человека de novo с массовым параллельным секвенированием с коротким чтением. Геном Res. 2010;20(2):265–72. пмид:20019144
  41. 41. Ли Х, Дурбин Р.Быстрое и точное выравнивание коротких прочтений с помощью преобразования Берроуза-Уилера. Биоинформатика (Оксфорд, Англия). 2009;25(14):1754–60.
  42. 42. Gnerre S, Maccallum I, Przybylski D, Ribeiro FJ, Burton JN, Walker BJ, et al. Высококачественные черновые сборки геномов млекопитающих на основе массивно параллельных данных о последовательностях. Proc Natl Acad Sci USA. 2011;108(4):1513–8. Центральный PMCID PubMed: PMCPMC3029755. пмид:21187386
  43. 43. Альтшул С.Ф., Мэдден Т.Л., Шеффер А.А., Чжан Дж., Чжан З., Миллер В. и др.Gapped BLAST и PSI-BLAST: новое поколение программ поиска белковых баз данных. Нуклеиновые Кислоты Res. 1997;25(17):3389–402. пмид:9254694
  44. 44. Камачо С., Кулурис Г., Авагян В., Ма Н., Пападопулос Дж., Билер К. и др. BLAST+: архитектура и приложения. Биоинформатика BMC. 2009;10(1).
  45. 45. Фрейзер Б.А., Уэдик С.Дж., Яновиц И., Родд Ф.Х. Секвенирование и характеристика транскриптома гуппи (Poecilia reticulata). Геномика BMC. 2011;12:202. пмид:21507250
  46. 46.Смит А., Хабли Р. RepeatModeler Open-1.0. 2010.
  47. 47. Гиш В. http://blast.advbiocomp.com 1996–2009 гг.
  48. 48. Смит А., Хабли Р., Грин П. RepeatMasker Open-3.0. 2010.
  49. 49. Навроцкий EP, Эдди SR. Infernal 1.1: поиск гомологии РНК в 100 раз быстрее. Биоинформатика (Оксфорд, Англия). 2013;29(22):2933–5.
  50. 50. Лоу ТМ, Эдди С.Р. tRNAscan-SE: программа для улучшенного обнаружения генов транспортной РНК в геномной последовательности.Нуклеиновые Кислоты Res. 1997;25(5):955–64. Центральный PMCID PubMed: PMCPMC146525. пмид:
    04
  51. 51. Курц С., Филлиппи А., Делчер А., Смут М., Шамуэй М., Антонеску С. и др. Универсальное и открытое программное обеспечение для сравнения больших геномов. Геном биол. 2004;5(2).
  52. 52. Крживинский М., Шейн Дж., Бироль И., Коннорс Дж., Гаскойн Р., Хорсман Д. и др. Circos: информационная эстетика для сравнительной геномики. Геном Res. 2009;19(9):1639–45. Центральный PMCID PubMed: PMCPMC2752132.пмид:19541911
  53. 53. Лойтиноя А., Голдман Н. Алгоритм последовательного множественного выравнивания последовательностей со вставками. Proc Natl Acad Sci U S A. 2005;102(30):10557–62. Центральный PMCID PubMed: PMCPMC1180752. пмид:16000407
  54. 54. Ян З. PAML 4: Филогенетический анализ методом максимального правдоподобия. Мол Биол Эвол. 2007;24(8):1586–91. пмид:17483113
  55. 55. Поланд Дж. А., Браун П. Дж., Сорреллс М. Е., Яннинк Дж. Л. Разработка генетических карт высокой плотности для ячменя и пшеницы с использованием нового подхода двухферментного генотипирования путем секвенирования.ПЛОС ОДИН. 2012;7(2):e32253. Центральный PMCID PubMed: PMCPMC3289635. пмид:22389690
  56. 56. Лангмид Б., Зальцберг С.Л. Быстрое выравнивание с промежутками чтения с Bowtie 2. Методы природы. 2012;9(4):357–9. пмид:22388286
  57. 57. МакКенна А., Ханна М., Бэнкс Э., Сиваченко А., Цибульскис К., Керницкий А. и др. Набор инструментов для анализа генома: платформа MapReduce для анализа данных секвенирования ДНК нового поколения. Геном Res. 2010;20(9):1297–303. пмид:20644199
  58. 58. Ли Х., Хэндсакер Б., Высокер А., Феннелл Т., Руан Дж., Гомер Н. и др.Формат Sequence Alignment/Map и SAMtools. Биоинформатика (Оксфорд, Англия). 2009;25(16):2078–9.
  59. 59. Гаррисон Э., Март Г. Обнаружение вариантов на основе гаплотипов при секвенировании с коротким считыванием. 2012.
  60. 60. Чинголани П., Платтс А., Ван Л.Л., Кун М., Нгуен Т., Ван Л. и др. Программа для аннотирования и прогнозирования эффектов однонуклеотидных полиморфизмов SnpEff: SNP в геноме штамма Drosophila melanogaster w1118; изо-2; изо-3. Флай (Остин). 2012;6(2):80–92.Центральный PMCID PubMed: PMCPMC3679285.
  61. 61. Торнтон К. Libsequence: библиотека классов C++ для эволюционного генетического анализа. 2003.
  62. 62. Ли Х., Дурбин Р. Вывод истории человеческой популяции на основе отдельных последовательностей всего генома. Природа. 2011;475(7357):493–6. пмид:21753753
  63. 63. Зербино Д., Бирни Э. Вельвет: Алгоритмы для сборки коротких чтений De Novo с использованием графиков Де Брейна. Геномные исследования. 2008;18:821–9. пмид:18349386
  64. 64.Симпсон Дж. Т., Вонг К., Джекман С. Д., Шейн Дж. Э., Джонс С. Дж. М., Бирол И. ABySS: параллельный ассемблер для коротких данных последовательностей чтения. Геномные исследования. 2009;19:1117–23. Центральный PMCID PubMed: PMCPMC2694472. пмид:19251739
  65. 65. Основная команда разработчиков R. R: язык и среда для статистических вычислений. 2014.
  66. 66. Грегори Т.Р., Никол Дж.А., Тамм Х., Куллман Б., Куллман К., Лейтч И.Дж. и др. Базы данных размеров генома эукариот. Нукл Кислоты Res. 2007; 35 (выпуск базы данных): D332–8.Центральный PMCID PubMed: PMCPMC1669731. пмид:170
  67. 67. Лейвер К.Р., Тейлор Дж.С. RT-qPCR выявляет активацию гена опсина, связанную с возрастом и полом, у гуппи (Poecilia reticulata) — вида с половым отбором на основе цвета и 11 генами зрительного опсина. БМС Эвол Биол. 2011;11:81. Эпб 31.03.2011. Центральный PMCID в PubMed: PMC3078887. пмид:21447186
  68. 68. Уотсон К.Т., Грей С.М., Хоффманн М., Лубенецкий К.П., Джой Дж.Б., Сандкам Б.А. и соавт. Дупликация генов и дивергенция генов длинноволнового опсина у гуппи Poecilia reticulata.Дж Мол Эвол. 2011;72(2):240–52. Эпублик 21.12.2010. пмид: 21170644
  69. 69. Уотсон К.Т., Лубенецкий К.П., Лоу Э., Дэвидсон В.С., Бреден Ф. Геномная организация дублированных генов опсинов, чувствительных к коротким и длинным волнам, у зеленого меченосца, Xiphorus helleri. БМС Эвол Биол. 2010;10:87. Эпб 2010/04/01. Центральный PMCID в PubMed: PMC3087554. пмид:20353595
  70. 70. Хоффманн М., Трипати Н., Хенц С.Р., Линдхольм А.К., Вайгель Д., Бреден Ф. и соавт. Дупликация и диверсификация гена опсина у гуппи, модель полового отбора.Proc Biol Sci. 2007; 274 (1606): 33–42. Центральный PMCID PubMed: PMCPMC1679887. пмид:17015333
  71. 71. Сандкам Б., Янг К.М., Бреден Ф. Красота в глазах смотрящих: цветовое зрение тринидадской гуппи (Poecilia reticulata) настроено на предпочтения партнера. Мол Экол. 2015;24(3):596–609. пмид:25556876
  72. 72. Рекнагель Х., Элмер К.Р., Мейер А. Гибридная карта генетического сцепления двух экологически и морфологически различных цихлид Мидас (Amphilophus spp.), полученный с помощью массивно-параллельного секвенирования ДНК (ddRADSeq). G3 (Бетесда). 2013;3(1):65–74. Центральный PMCID в PubMed: PMC3538344.
  73. 73. Шен ММ, Шир АФ. Семейство генов EGF-CFC в развитии позвоночных. Тенденции в генетике: TIG. 2000;16(7):303–9. Эпублик 20.06.2000. пмид:10858660
  74. 74. Айраксинен М.С., Холм Л., Хатинен Т. Эволюция лигандов и рецепторов семейства GDNF. Мозг, поведение и эволюция. 2006;68(3):181–90. Эпб 2006/08/17. пмид:161
  75. 75.Ду Дж., Миллер А.Дж., Видлунд Х.Р., Хорстманн М.А., Рамасвами С., Фишер Д.Э. MLANA/MART1 и SILV/PMEL17/GP100 транскрипционно регулируются MITF в меланоцитах и ​​меланоме. Ам Джей Патол. 2003;163(1):333–43. Центральный PMCID PubMed: PMCPMC1868174. пмид:12819038
  76. 76. Фукамачи С., Асакава С., Вакамацу Й., Симидзу Н., Митани Х., Шима А. Сохраняющаяся функция разбавления медаки с розовыми глазами в синтезе меланина и его дивергентная регуляция транскрипции в гонадах у позвоночных.Генетика. 2004;168(3):1519–27. Эпублик 2004/12/08. Центральный PMCID в PubMed: PMC1448775. пмид:15579703
  77. 77. Ян К.Т., Хиндес А.Е., Халтман К.А., Джонсон С.Л. Мутации в gfpt1 и skiv2l2 вызывают отчетливые специфичные для стадии дефекты личиночной регенерации меланоцитов у рыбок данио. Генетика PLoS. 2007;3(6):e88. Эпб 2007/06/05. Центральный PMCID в PubMed: PMC1885281. пмид:17542649
  78. 78. Каваучи Х., Бейкер Б.И. Сигнальные системы меланинконцентрирующего гормона у рыб. Пептиды. 2004;25(10):1577–84.Эпублик 13.10.2004. пмид:15476924
  79. 79. Негиши С., Фудзимото К., Катох С. Локализация сепиаптеринредуктазы в пигментных клетках Oryzias latipes. Исследование пигментных клеток / спонсируется Европейским обществом исследований пигментных клеток и Международным обществом пигментных клеток. 2003;16(5):501–3. Эпб 2003/09/03. пмид:12950727
  80. 80. Park JY, Jang H, Curry TE, Sakamoto A, Jo M. Муциноподобный белок 1, регулируемый андрогенами простаты: новый регулятор метаболизма прогестерона.Молекулярная эндокринология. 2013;27(11):1871–86. Эпб 2013/10/03. Центральный PMCID в PubMed: PMC3805850. пмид:24085821
  81. 81. Лавленд Дж.Л., Уй Н., Марушка К.П., Карпентер Р.Э., Фернальд Р.Д. Различия в социальном статусе регулируют серотонинергическую систему цихлид Astatotilapia burtoni. Журнал экспериментальной биологии. 2014; 217 (часть 15): 2680–90. Эпб 2014/05/24. пмид: 24855673
  82. 82. Джонен Х., Гонсалес-Сильва Л., Каррамолино Л., Флорес Дж.М., Торрес М., Сальвадор Дж.М.Gadd45g необходим для первичного определения пола, мужской фертильности и развития семенников. ПЛОС Один. 2013;8(3):e58751. Эпб 2013/03/22. Центральный PMCID в PubMed: PMC3596291. пмид: 23516551
  83. 83. Шартл М., Уолтер Р.Б., Шен Ю., Гарсия Т., Катчен Дж., Аморес А. и др. Геном утконосов Xiphophorus maculatus дает представление об эволюционной адаптации и некоторых сложных чертах. Нат Жене. 2013.
  84. 84. Фишер С., Коблмюллер С., Галли С., Шлоттерер С., Штурмбауэр С., Таллингер Г.Г.Полные последовательности митохондриальной ДНК цихлид с нитевидными плавниками (Petrochromis trewavasae) и тупорылых цихлид (Tropheus moorii) и закономерности эволюции митохондриального генома у цихлид. ПЛОС Один. 2013;8(6):e67048. Центральный PMCID PubMed: PMCPMC36

    . пмид:23826193
  85. 85. Шарма Э., Кюнстнер А., Фрейзер Б.А., Зипприх Г., Коттлер В.А., Хенц С.Р. и соавт. Сборки транскриптомов для изучения экспрессии генов, зависящих от пола, у гуппи Poecilia reticulata. Геномика BMC. 2014;15:400.Центральный PMCID в PubMed: PMC4059875. пмид: 24886435
  86. 86. Коттлер В.А., Кунстнер А., Кох И., Флотенмейер М., Лангенекер Т., Хоффманн М. и соавт. Аденилатциклаза 5 необходима для развития меланофора и мужского пола у гуппи (Poecilia reticulata). Пигментно-клеточная меланома Res. 2015;28(5):545–58. пмид: 26079969
  87. 87. Дрейер С., Хоффманн М., Ланц С., Уиллинг Э.М., Ристер М., Вартманн Н. и др. EST и EST-связанные полиморфизмы для генетического картирования и филогенетической реконструкции у гуппи, Poecilia reticulata.Геномика BMC. 2007; 8:269. Центральный PMCID PubMed: PMCPMC1994688. пмид:17686157
  88. 88. Фрейзер Б.А., Кунстнер А., Резник Д.Н., Дрейер С., Вайгель Д. Популяционная геномика природных и экспериментальных популяций гуппи (Poecilia reticulata). Мол Экол. 2015;24(2):389–408. пмид:25444454
  89. 89. Ward MN, Churcher AM, Dick KJ, Laver CR, Owens GL, Polack MD, et al. Молекулярная основа цветового зрения у цветных рыб: четыре чувствительных к длинным волнам (LWS) опсина у гуппи (Poecilia reticulata) определяются заменами аминокислот в ключевых функциональных участках.БМС Эвол Биол. 2008; 8:210. Эпублик 22.07.2008. пмид:18638376
  90. 90. Weadick CJ, Chang B. Длинноволновые зрительные пигменты гуппи (Poecilia reticulata): шесть опсинов, выраженных у одного человека. БМС Эвол Биол. 2007.
  91. 91. Бахтрог Д., Киркпатрик М., Манк Дж. Э., Макдэниел С. Ф., Пирес Дж. К., Райс В. и др. Все ли половые хромосомы одинаковы? Тенденции в генетике: TIG. 2011;27(9):350–7. пмид:21962970
  92. 92. Бахтрог Д. Эволюция Y-хромосомы: новое понимание процессов дегенерации Y-хромосомы.Нат Рев Жене. 2013;14(2):113–24. Центральный PMCID PubMed: PMCPMC4120474. пмид:23329112
  93. 93. Эллегрен Х. Эволюция половых хромосом: недавний прогресс и влияние мужской и женской гетерогаметности. Нат Рев Жене. 2011;12(3):157–66. пмид:21301475

Пецилии: размножение и уход в домашних условиях. Аквариумные рыбки пецилии: описание, содержание

Рыбка пецилия, размножение которой, как правило, происходит без лишних хлопот, считается довольно частым обитателем современных жилых уголков.Часто встречается не только в огромных офисных аквариумах, но и в обычных домашних, средних и даже очень скромных размеров.

В целом следует отметить, что пецилия – это рыбка, содержание которой не станет проблематичным даже для новичков в мире аквариумистики.

Эта статья расскажет вам об этом более подробно. Читатель познакомится со всей необходимой информацией, касающейся мест обитания, особенностей питания и внешнего вида такого интересного обитателя подводного мира, как пецилия.Размножение и разведение в домашних условиях также будет затронуто в отдельных разделах. Ознакомившись со всеми предоставленными фактами, любой желающий легко сможет завести такую ​​рыбку в качестве домашнего питомца.

Раздел 1. Общие сведения и условия обитания в природе

Пецилия – рыба, очень популярный обитатель современных аквариумов. Почему? Скорее всего, благодаря своей неприхотливости, легкости в разведении, красоте, разнообразию окрасов.

Однако не все знают, что его естественным ареалом является Северная и Центральная Америка.Особенно часто встречается в Веракрусе в Мексике. Кроме того, встретить пецилию можно в Калифорнии, Колорадо, Флориде, Луизиане, Неваде, Техасе, на Гавайях, но сюда ее завезли искусственно.

Раздел 2. Внешний вид рыб

Пецилии, содержание которых не только простое, но и достаточно интересное и информативное — довольно мелкая рыбка, ее длина редко превышает 3,5-5 см, а средняя продолжительность жизни находится в пределах 3-4 годы.

Его внешний вид, впрочем, как и расцветку описать сложно из-за большого разнообразия вариантов.С уверенностью можно сказать, что женская пецилия не такая яркая и пестрая, как мужская.

Ученые выделяют множество разновидностей. Например, нельзя не упомянуть о дисковых пецилиях. У него необычный сильно искривленный позвоночник и особая форма тела. Но красная пецилия гораздо подвижнее других видов.

Раздел 3. Половые различия рыб

Половые различия у этих рыб более чем яркие. Самки визуально крупнее, имеют менее яркую окраску, более широкий анальный плавник.Кроме того, у них более полное и округлое брюшко.

У самцов анальный плавник маленький и заостренный на конце, окраска тела красивая и очень яркая. Они, как правило, считаются настоящим украшением современных аквариумов.

Раздел 4. Необходимые условия для разведения рыб

Разводить пецилий легко, так как никаких особых условий для этого не требуется. Кстати, многие аквариумисты даже смеются, говоря, что потом остановить размножение этих рыб гораздо сложнее, чем запустить его.И это действительно так.

Итак, у вас была пецилия? Размножение этих обитателей подводного мира не заставляет себя долго ждать. Чтобы самки нормально и регулярно беременели, одного самца будет достаточно на 3 самок. Это количество является оптимальным, так как значительно снижает конкуренцию самцов и в то же время дает самкам возможность на время отдохнуть от них.

Пецилии являются живородящими рыбами, то есть они вынашивают икру внутри тела и на свет сразу появляется сформировавшийся самец, умеющий плавать.Беременность самки легко определить по округлому брюшку, а также по темному пятну возле анального плавника. Самка легко может рожать каждые 28 дней, при среднем количестве мальков — 20-40 штук.

Как правило, роды пецилий несложные. Хотя беременную самку все же желательно отсадить в отдельный аквариум и добавить в него больше растений. В это время будущую маму не нужно лишний раз беспокоить, поэтому переднее стекло рекомендуется закрыть бумагой.

R Раздел 5. Уход за мальками

Важно учитывать, что пецилии поедают своих мальков, чтобы они выжили, следует высадить много растений, либо их можно сразу отсадить в отдельную емкость.

Дальнейший уход за мальком достаточно прост, ведь он рождается крупным и хорошо сформированным. Кормить их можно яичным желтком, специальными измельченными кормами или простым сухим. При обильном кормлении и чистой воде уже через 3 месяца новорожденные малыши сами станут половозрелыми.

Раздел 6. Как правильно кормить

В природе пецилии, размножение которых происходит регулярно и без особых проблем, в основном питаются насекомыми и водорослями. А вот в аквариуме они с большим удовольствием поедают практически любые корма.

Очень важно включать в свой рацион специализированные подкормки с клетчаткой, например, хлопья с растительными компонентами или такие овощи, как огурцы, кабачки, шпинат. Такая растительная пища способствует лучшей работе желудочно-кишечного тракта.А вот комбикорм может быть любым, например, хорошо подойдет мотыль, трубочник, артемия, коретра.

Раздел 7. Сложности содержания и ухода

Пецилии, содержание которых не требует особых навыков, отлично подойдет как начинающим аквариумистам, так и профессионалам.

Как и почти все живородящие рыбки, пецилии неприхотливы и покладисты. Их можно содержать в небольших аквариумах, от 40-50 литров. Конечно, лучше, чтобы объем был большим. Между собой пецилии не проявляют агрессии (как, например, меченосцы), и их можно содержать при незначительном преобладании самок.

Что касается параметров воды, то здесь они тоже не слишком капризны. Идеальная — вода средней жесткости (15-30 dGH), кислотность желательна в пределах 7,0-8,3, оптимальная температура воды 22-25С. Главное, чтобы вода была чистая и свежая, лучший вариант – частичное заполнение определенной части воды, как правило, не менее 20% в неделю.

Фильтрация и аэрация, конечно, желательны, но в случае, если аквариум не перенаселен, ею вполне можно пренебречь.

Раздел 8.Совместимость с другими обитателями аквариума

Еще один плюс пецилий в том, что они прекрасно уживаются в общем аквариуме, совершенно не задевают других рыбок.

Но нужно учитывать, что для самих хищников они могут стать легкой добычей. Именно поэтому пецилии лучше всего размещать с другими живородящими, например, с моллинезиями или меч-рыбами.

р>

Эффекты аудитории в атлантической моллинезии (Poecilia mexicana) – осмотрительный выбор партнера самцом в ответ на предполагаемый риск конкуренции сперматозоидов? | Frontiers in Zoology

  • Pruett-Jones S: Независимый и ненезависимый выбор партнера: самки копируют друг друга?Я Нат. 1992, 140: 1000-1009. 10.1086/285452.

    КАС Статья пабмед Google ученый

  • Westneat DF, Walters A, McCarthy TM, Hatch MI, Hein WK: Альтернативные механизмы независимого выбора партнера. Аним Бехав. 2000, 59: 467-476. 10.1006/anbe.1999.1341.

    Артикул пабмед Google ученый

  • Джонстон Р.А.: Подслушивание и конфликты с животными.Proc Natl Acad Sci USA. 2001, 98: 9177-9180. 10.1073/пнас.161058798.

    Центральный пабмед КАС Статья пабмед Google ученый

  • Белый ди-джей: Влияние социального обучения на решения о выборе партнера. Изучите поведение. 2004, 32: 105-113.

    Артикул пабмед Google ученый

  • Эрли Р.Л., Дугаткин Л.А.: Борьба, спаривание и создание сетей: столпы социальности пецилиидов.Сети общения животных. Под редакцией: МакГрегор П.К. 2005, Издательство Кембриджского университета, Кембридж, Массачусетс, 84–113.

    Глава Google ученый

  • Бонни К.Е., Эрли Р.Л.: Расширение возможностей использования социальной информации. Аним Бехав. 2007, 74: 171-181. 10.1016/j.anbehav.2006.12.009.

    Артикул Google ученый

  • Друен М., Дугаткин А.Л.: Сети связи.Экология и эволюция живородящих рыб (Poeciliidae). Под редакцией: Эванс Дж., Пиластро А., Шлупп И. 2009, издательство Чикагского университета, Чикаго, Иллинойс,

    Google ученый

  • Nordell SE, Valone TJ: Mate selection копируется как общедоступная информация. Эколь Летт. 1998, 1: 74-76. 10.1046/j.1461-0248.1998.00025.х.

    Артикул Google ученый

  • Матош Р., Шлупп И.: Выступление перед публикой – связисты и социальная среда.Сети общения животных. Под редакцией: МакГрегор П.К. 2005, Издательство Кембриджского университета, Кембридж, Массачусетс, 63-83.

    Глава Google ученый

  • Плат М., Блюм Д., Шлупп И., Тидеманн Р.: Эффект аудитории изменяет предпочтения при спаривании у самцов атлантической молли ( Poecilia mexicana ). Аним Бехав. 2008, 75: 21-29. 10.1016/j.anbehav.2007.05.013.

    Артикул Google ученый

  • Плат М., Блюм Д., Тидеманн Р., Шлупп И.: Эффект визуальной аудитории у пещерной рыбы.Поведение. 2008, 145: 931-947. 10.1163/156853

  • 4089225.

    Артикул Google ученый

  • Плат М., Рихтер С., Тидеманн Р., Шлупп И.: Рыбы-самцы обманывают конкурентов относительно предпочтений при спаривании. Карр Биол. 2008, 18: 1138-1141. 10.1016/j.cub.2008.06.067.

    КАС Статья пабмед Google ученый

  • Плат М., Кромущински К., Тидеманн Р.: Эффект аудитории изменяет предпочтения самцов, но не самок.Behav Ecol Sociobiol. 2009, 63: 381-390. 10.1007/s00265-008-0672-7.

    Артикул Google ученый

  • Valone TJ: От подслушивания производительности до копирования поведения других: обзор использования общедоступной информации. Behav Ecol Sociobiol. 2007, 62: 1-14. 10.1007/s00265-007-0439-6.

    Артикул Google ученый

  • Valone TJ, Templeton JJ: Публичная информация для оценки качества: широко распространенное социальное явление.Phil Trans R Soc Lond Biol Sci. 2002, 357: 1549-1557. 10.1098/рстб.2002.1064.

    Артикул Google ученый

  • Danchin E, Giraldeau LA, Valone TJ, Wagner RH: Общественная информация: от любопытных соседей к культурной эволюции. Наука. 2004, 305: 487-491. 10.1126/научн.1098254.

    КАС Статья пабмед Google ученый

  • Dabelsteen T: общедоступный, частный или анонимный: облегчение и противодействие подслушиванию.Сети общения животных. Под редакцией: МакГрегор П.К. 2005, издательство Кембриджского университета, Кембридж, 38–62.

    Глава Google ученый

  • Гросеник Л., Клемент Т.С., Фернальд Р.Д.: Рыба может определить социальный статус только на основании наблюдения. Природа. 2007, 445: 429-432. 10.1038/природа05511.

    КАС Статья пабмед Google ученый

  • Oliveira RF, McGregor PK, Latruffe C: Знай своего врага: боевые рыбы собирают информацию, наблюдая за взаимодействием сородичей.Proc R Soc Lond B. 1998, 265: 1045-1049. 10.1098/рспб.1998.0397.

    Артикул Google ученый

  • Doutrelant C, McGregor PK, Oliveira RF: Влияние аудитории на внутриполовое общение самцов сиамских бойцовых рыб, Betta splendens . Поведение Экол. 2001, 12: 283-286. 10.1093/beheco/12.3.283.

    Артикул Google ученый

  • McGregor PK, Peake TM, Lampe HM: Fighting fish Betta splendens извлекает относительную информацию из очевидных взаимодействий: что происходит, когда то, что вы видите, не то, что вы получаете.Аним Бехав. 2001, 62: 1059-1065. 10.1006/anbe.2001.1850.

    Артикул Google ученый

  • Oliveira RF, Lopes M, Carneiro LA, Canário AVM: просмотр боев повышает уровень рыбьего гормона. Природа. 2001, 409-475.

    Google ученый

  • Браун К., Лаланд К.Н.: Социальное обучение у рыб: обзор. Рыбное рыболовство. 2003, 4: 280-288. 10.1046/j.1467-2979.2003.00122.х.

    Артикул Google ученый

  • Эрли Р.Л., Дугаткин Л.А.: Подслушивание визуальных сигналов в драках зеленых меченосцев ( Xiphophorus helleri ): случай для создания сети.Proc R Soc Lond B. 2002, 269: 943-952. 10.1098/рспб.2002.1973.

    Артикул Google ученый

  • Эрли Р.Л., Друэн М., Дугаткин Л.А.: Наблюдение за боями не меняет реакцию стороннего наблюдателя на наивных сородичей самцов зеленой меченосцы, Xiphophorus helleri . Аним Бехав. 2005, 69: 1139-1145. 10.1016/j.anbehav.2004.07.015.

    Артикул Google ученый

  • Оттер К., МакГрегор П.К., Терри А.М.Р., Берфорд Ф.Р.Л., Пик Т.М., Дабельстин Т.: Оценивают ли самки больших синиц ( Parus major ) самцов, подслушивая? Полевое исследование с использованием интерактивного воспроизведения песни.Proc R Soc Lond B. 1999, 266: 1305-1309. 10.1098/рспб.1999.0779.

    Артикул Google ученый

  • Дутрелан К., МакГрегор П.К.: Подслушивание и выбор партнера самками бойцовых рыб. Поведение. 2000, 137: 1655-1669. 10.1163/156853

    2763.

    Артикул Google ученый

  • Офир А., Галеф Б.Г.: Самки японских перепелов, которые «подслушивают» дерущихся самцов, предпочитают проигравших победителям.Аним Бехав. 2003, 66: 399-407. 10.1006/anbe.2003.2230.

    Артикул Google ученый

  • Дугаткин Л.А. Половой отбор и подражание: самки копируют чужой выбор партнера. Я Нат. 1992, 139: 1384-1389. 10.1086/285392.

    Артикул Google ученый

  • Mennill DJ, Boag PT, Ratcliffe LM: Репродуктивный выбор подслушивающих самок черношапочных синиц, Poecile atricapillus .Натурвиссеншафтен. 2003, 90: 577-582. 10.1007/s00114-003-0479-3.

    КАС Статья пабмед Google ученый

  • Aquiloni L, Buøiè M, Gherardi F: Самки раков подслушивают дерущихся самцов, прежде чем выбрать доминирующего партнера. Карр Биол. 2008, 18: Р462-Р463. 10.1016/j.cub.2008.04.006.

    КАС Статья пабмед Google ученый

  • Schlupp I, Ryan MJ: Самцы парусных моллинезий ( Poecilia latipinna ) копируют выбор партнера другими самцами.Поведение Экол. 1997, 8: 104-107. 10.1093/beheco/8.1.104.

    Артикул Google ученый

  • Галеф Б.Г., Белый ди-джей: Mate selection копирует японских перепелов, Coturnix coturnix japonica . Аним Бехав. 1998, 55: 545-552. 10.1006/anbe.1997.0616.

    Артикул Google ученый

  • Витте К., Райан М.Дж.: Копирование выбора партнера в парусной молли, Poecilia latipinna , в дикой природе.Аним Бехав. 2002, 63: 943-949. 10.1006/anbe.2001.1982.

    Артикул Google ученый

  • Godin J-GJ, Herdman EJE, Dugatkin LA: Социальное влияние на выбор самки гуппи, Poecilia reticulata : генерализованное и повторяющееся поведение копирования признаков. Аним Бехав. 2005, 69: 999-1005. 10.1016/j.anbehav.2004.07.016.

    Артикул Google ученый

  • Марлер П., Дафти А., Пикерт Р.: Голосовая коммуникация у домашней курицы.II. Чувствителен ли отправитель к присутствию и характеру получателя? Аним Бехав. 1986, 34: 194-198. 10.1016/0003-3472(86)-0.

    Артикул Google ученый

  • Матос Р.Дж., МакГрегор П.К.: Влияние пола аудитории на демонстрацию сиамских бойцовых рыб самцами ( Betta splendens ). Поведение. 2002, 139: 1211-1222. 10.1163/156853437344.

    Артикул Google ученый

  • Матос Р.Дж., Пик Т.М., МакГрегор П.К.: Время представления публики: агрессивный прайминг и эффекты аудитории при демонстрации самцов сиамских бойцовых рыб ( Betta splendens ).Поведение Proc. 2003, 63: 53-61. 10.1016/S0376-6357(03)00029-9.

    Артикул Google ученый

  • Вигнал К., Матевон Н., Моттин С.: Аудитория вызывает реакцию самца певчей птицы на голос партнера. Природа. 2004, 430: 448-451. 10.1038/природа02645.

    КАС Статья пабмед Google ученый

  • Дзевечинский Т.Л., Эрли Р.Л., Грин Т.М., Роуленд В.Дж.: Эффект аудитории зависит от контекста в сиамских бойцовых рыбках, Betta splendens .Поведение Экол. 2005, 16: 1025-1030. 10.1093/beheco/ari088.

    Артикул Google ученый

  • Дзивечински Т.Л., Бесслер А.М., Шелтон Д.С., Роуленд В.Дж.: Влияние фиктивной аудитории на взаимодействие самцов и самцов у сиамских бойцовых рыб, Betta splendens . Этология. 2006, 112: 127-133. 10.1111/j.1439-0310.2006.01144.х.

    Артикул Google ученый

  • Plath M, Schlupp I: Вводящие в заблуждение моллинезии – влияние аудитории на выражение предпочтений при спаривании.Связь Интегр Биол. 2008, 1: 199-203.

    Артикул Google ученый

  • Таунсенд С., Зубербюлер К. Эффекты аудитории в криках совокупления шимпанзе. Связь Интегр Биол. 2009, 2: 155-157.

    Артикул Google ученый

  • Фишер Х.С., Розенталь Г.Г.: Двор самцов меченосцев с заботой о публике. Биол Летт. 2006, 3: 5-7. 10.1098/rsbl.2006.0556.

    Центральный пабмед Статья Google ученый

  • Dzieweczynski TL, Rowland WL: За закрытыми дверями: использование визуальной бухты при ухаживании за самцом трехиглой колюшки, Gasterosteus aculeatus .Аним Бехав. 2004, 68: 465-471. 10.1016/j.anbehav.2003.08.024.

    Артикул Google ученый

  • Досен Л.Д., Монтгомери Р.: Предпочтения самцов гуппи ( Poecilia reticulata ) в отношении риска конкуренции сперматозоидов. Behav Ecol Sociobiol. 2004, 55: 266-271. 10.1007/s00265-003-0710-4.

    Артикул Google ученый

  • Вонг ББМ, Маккарти М.: Осторожный выбор самца в условиях предполагаемого риска конкуренции сперматозоидов у восточных рыб-москитов.Поведение Экол. 2009, 20: 278-282. 10.1093/beheco/arp010.

    Артикул Google ученый

  • Constanz GD: Конкуренция сперматозоидов у пецилиевых рыб. Конкуренция сперматозоидов и эволюция систем спаривания животных. Под редакцией: Смит Р.Л. 1984, Академик Пресс, Нью-Йорк, 465–485.

    Google ученый

  • Parzefall J: Zur vergleichenden Ethologie verschiedener Mollienesia -Arten einschließlich einer Höhlenform von Mollienesia sphenops .Поведение. 1969, 33: 1-37. 10.1163/156853969X00297.

    КАС Статья пабмед Google ученый

  • Plath M, Parzefall J, Schlupp I: Роль сексуальных домогательств в пещерных и поверхностных популяциях атлантической моллинезии, Poecilia mexicana (Poeciliidae, Teleostei). Behav Ecol Sociobiol. 2003, 54: 303-309. 10.1007/s00265-003-0625-0.

    Артикул Google ученый

  • Плат М., Макович А.М., Шлупп И., Тоблер М.: Сексуальные домогательства у живородящих рыб: сравнение ухаживающих и не ухаживающих видов.Поведение Экол. 2007, 18: 680-688. 10.1093/beheco/arm030.

    Артикул Google ученый

  • Макгрегор П.К., Пик Т.М.: Коммуникационные сети: социальная среда для приема и передачи сигналов о поведении. Акта Этолог. 2000, 2: 71-81. 10.1007/s102110000015.

    Артикул Google ученый

  • Гриффитс С.В., Магурран А.Е. Половое и школьное поведение тринидадской гуппи.Аним Бехав. 1998, 56: 689-693. 10.1006/anbe.1998.0767.

    Артикул пабмед Google ученый

  • Рассел С.Т., Келли Дж.Л., Грейвс Дж.А., Магурран А.Е.: Динамика родственной структуры и состава стаи гуппи, Poecilia reticulata . Ойкос. 2004, 106: 520-526. 10.1111/j.0030-1299.2004.12847.х.

    Артикул Google ученый

  • Крофт Д.П., Джеймс Р., Томас П.О.Р., Хэтэуэй С., Модсли Д., Лаланд К.Н., Краузе Дж.: Социальная структура и кооперативные взаимодействия в дикой популяции гуппи ( Poecilia reticulata ).Behav Ecol Sociobiol. 2006, 59: 644-650. 10.1007/с00265-005-0091-у.

    Артикул Google ученый

  • Даррен П., Крофт Д.П., Альбанезе Б., Эрроусмит Б.Дж., Ботам М., Вебстер М., Краузе Дж.: Половой мотив в гуппи ( Poecilia reticulata ). Экология. 2003, 137: 62-68. 10.1007/s00442-003-1268-6.

    Артикул Google ученый

  • Evans JP, Pilastro A: Посткопуляционный половой отбор у пецилиевых рыб.Экология и эволюция живородящих рыб (Poeciliidae). Под редакцией: Evans J, Pilastro A, Schlupp I. 2009,

    Google ученый

  • Гревен Х. Гонады, гениталии и репродуктивная биология. Экология и эволюция живородящих рыб (Poeciliidae). Под редакцией: Эванс Дж., Пиластро А., Шлупп И. 2009, издательство Чикагского университета, Чикаго, Иллинойс,

    Google ученый

  • Evans JP, Pierotti M, Pilastro A: Поведение самцов при спаривании и расход эякулята в условиях риска конкуренции сперматозоидов у восточных рыб-москитов.Поведение Экол. 2003, 14: 268-273. 10.1093/beheco/14.2.268.

    Артикул Google ученый

  • Aspbury AS: Влияние конкуренции сперматозоидов на производство и расход спермы у парусных моллинезий, Poecilia latipinna . Поведение Экол. 2007, 18: 776-780. 10.1093/beheco/arm044.

    Артикул Google ученый

  • Bisazza A, Marconato A, Marin G: Предпочтение самцов у рыб-москитов Gambusia holbrooki .Этология. 1989, 83: 335-343.

    Артикул Google ученый

  • Herdman EJE, Kelly CD, Godin J-GJ: Выбор самца у гуппи ( Poecilia reticulata ): самцы предпочитают более крупных самок в качестве партнеров?. Этология. 2004, 110: 97-111. 10.1111/j.1439-0310.2003.00960.х.

    Артикул Google ученый

  • Poeciliidae), интродуцированная в Бразилию с помощью α-таксономии и ДНК-штрихкодирования

    Идентификация интродуцированной мексиканской моллинезии с помощью ДНК-штрихкодирования Bragança et al.

    332 Cybium 2019, 43(4)

    2005; Мередит и др., 2011). Кроме того, пецилииды известны

    большим числом интродуцированных видов, вызванных случайными

    интродукциями и преднамеренными

    интродукциями для борьбы с личинками комаров (Courtenay and Meffe, 1989;

    Sherley, 2000; Evans et al.). al., 2011; Stockwell and Henkanath-

    thegedara, 2011). Род Poecilia является самым разнообразным

    родом Poeciliidae, и его виды относятся к десяти

    подродам: Acanthophacelus Eigenmann, 1907, Allopoecilia

    Hubbs, 1924, Curtipenis Rivas & Myers, 1950, Limia Poey,

    3,

    3 Micropoecilia Hubbs, 1926, Mollienesia Lesueur,

    1821, Poecilia Bloch & Schneider 1801, Pamphorichthys

    Regan, 1913, Pseudolimia Poeser, 2002 и Psychropoeci-

    lia Myers, 1.Paallacio

    lia Myers, 1., 2016). Однако были предложены и другие классификации, основанные только на филогенетическом анализе морфологических данных (Lucinda and Reis, 2005) или

    молекулярных филогениях (Meredith et al., 2011). Здесь мы следуем классификации, предложенной Palacios et al. (2016).

    Виды Mollienesia широко распространены в Центральной Америке, встречаются как в Тихоокеанском, так и в Атлантическом бассейнах

    возрастов, и подразделяются на две хорошо установленные и обособленные

    группы:

    укороченную и группы видов парусников (Ptacek

    и Breden, 1998; Alda et al., 2013). Однако оценка разнообразия Mollienesia особенно сложна при рассмотрении только традиционной альфа-таксономии, потому что род

    демонстрирует внутривидовую пластичность, которая может превышать дивергенцию

    между видами, скрывая межвидовые различия. вариант c (Poeser,

    2011). Кроме того, для Mollienesia отмечены значительные индивидуальные, онтогенетические, сезонные и географические вариации (Rivas, 1978).Эти особые условия

    поддерживают использование ДНК-штрих-кодирования для идентификации видов Mollienesia

    , а также для идентификации инвазивных видов Mollienesia

    .

    Rosen and Bailey (1963) считали, что все виды короткоплавниковых

    Mollienesia представляют собой местные варианты P. sphe-

    nops Valenciennes, 1864, но последующие исследования показали, что группа короткоплавниковых

    включает различные виды с частично

    перекрываются географическими ареалами (Schultz and Miller, 1971;

    Menzel and Darnell, 1973; Miller, 1975; Poeser, 1992).

    Несмотря на чрезвычайно схожую морфологию и окраску

    рисунков, Menzel and Darnell (1973), вслед за Schultz и

    Miller (1971), выделили две группы коротких видов и

    удалили P. mexicana Steindachner, 1863 из синонима

    с P. sphenops. Были установлены две видовые группы:

    видовая группа P. mexicana, включающая виды с однокуспидальными

    зубами во внутренних рядах зубной и межчелюстной костей, и

    менее разнообразный P.sphenops, включая виды с тремя клыками. Однако различение видов из

    обеих групп иногда бывает затруднительным, если принять во внимание наличие между ними естественных гибридов и кажущуюся рецессивную природу трехстворчатых зубов у потомков между

    скрещиваниями видов из обеих групп. (Шульц и Миллер,

    1971; Мензел и Дарнелл, 1973; Тернер и др., 1980; Позер,

    2003).В последнее время молекулярные подходы к разграничению видов в Mollienesia поддерживали обе краткосрочные группы видов,

    , что привело к созданию большой базы данных гаплотипов различных видов

    и популяций (Alda et al., 2013; Bagley et al., 2015; Pala-

    cios et al., 2016).

    Целью настоящего исследования является таксономическая

    идентификация короткого вида Mollienesia, обнаруженного в Сан

    Остров Луис, штат Мараньян, на северо-востоке Бразилии, отслеживание

    его происхождения в Центральной Америке, и определение генетической структуры инвазивных видов.Также представлено краткое обсуждение

    идентификации предыдущих инвазивных видов Mollienesia в Бразилии, а также информация о среде обитания, в которой были обнаружены неместные виды.

    МАТЕРИАЛЫ И МЕТОДЫ

    Отбор проб таксонов

    Лица, отобранные для данного исследования, были подвергнуты эвтаназии

    буферным раствором MS-222 в концентрации

    движения полностью прекратились.Образцы, отобранные для

    морфологического анализа, фиксировали в формалине и оставляли на

    10 сут, после чего консервировали в 70%-ном этиловом спирте.

    Молекулярные данные были получены для образцов, которые были

    подвергнуты эвтаназии, зафиксированы и сохранены в абсолютном этаноле. Остеологические исследования проводились на очищенных и окрашенных образцах

    (C&S), приготовленных в соответствии с Taylor and Van Dyke (1985),

    , и номенклатурой гоноподиальных структур по Rosen

    и Gordon (1953).Ваучеры депонированы в Coleção

    IctioLógica do Centro de Ciências Agrárias e Umbientais da

    Universidade Federal Do

    Universadade Do

    и Coleção

    Ictiológica do instituto de Biologia da Universidade Fede-

    RAL DO RAL DO RIOE DE JANEIRO (UFRJ). Все образцы были собраны

    с разрешениями 51540-3/ от SISBIO (Бразильский институт

    Окружающая среда и природные ресурсы).

    Исследованный материал

    Poecilia butleri Jordan, 1889: UFRJ 4038, 22 ex.; UFRJ

    4053, 3 экз. К&С; Река Мокорито, примерно в 3/4 милях от Гуа-

    мучиль, Мексика; Р.Г. Миллер; 6 мая 1942 г. Poecilia gillii

    (Kner, 1863): UFRJ 4037, 22 экз.; UFRJ 4051, 3 экз. К&С;

    Река Ликус, приток реки Вава возле Васпами, Никара-

    гуа; Р. Р. Миллер, Ф. Х. Миллер, Г. Глодек, П. Запата; 13 мая

    1975. Poecilia maylandi Meyer, 1983: UFRJ 4036, 22 экз.;

    UFRJ 4088, 3 шт. К&С; Река Тепалькатепек, сток Бальсас,

    Новая Италия, Мексика; С.Д. Барбур, Р.Дж. Дуглас. Poecilia

    mexicana Steindachner, 1863: UFRJ 4035, 22 экз.; UFRJ

    4057, 3 экз. К&С; Река Сан-Маркос и небольшой приток на

    шоссе 130, мост к северо-востоку от Вила Камачо, 55 км от

    Поса-Рика, приток реки Касонес, Мексика; Р. Р. Миллер,

    Ф. Х. Миллер, Н. Нефф; 15 декабря 1972 г .; CICCAA 02354, 7 отл.;

    открытая местность в мангровом лесу устья реки Анил, Сан

    Муниципалитет Луис, штат Мараньян, северо-восточная Бразилия; Э.C.

    Наследование маркеров RAPD у рыбок гуппи, Poecilia reticulata

    ВВЕДЕНИЕ

    Новый метод выявления полиморфизмов на основе ДНК с помощью фингерпринтинга случайной амплифицированной полиморфной ДНК (RAPD), который включает ПЦР-амплификацию геномной ДНК с использованием одного праймера произвольной последовательности нуклеотидов, было сообщено в 1990 г. [20, 24]. С тех пор метод RAPD применялся к широкому кругу организмов, и его преимущества перед методом RFLP-дактилоскопии были подробно рассмотрены [1–3, 10, 12, 14, 17, 20, 22, 24, 26].Однако сообщений о снятии отпечатков пальцев с помощью RAPD у рыб немного. Снятие отпечатков пальцев RAPD использовалось Dinesh et al. [56–7] для выявления полиморфизмов ДНК у некоторых видов рыб, включая цветные разновидности гуппи (Poecilia reticulata) и тигрового барбуса (Barbus tetrazona). Кубота и др. [15] использовали этот метод для выявления радиационно-индуцированных повреждений ДНК у медаки Oryzias latipes. Недавно Johnson et al. [13] идентифицировали 721 полиморфизм RAPD между двумя лабораторными штаммами рыбок данио, Danio rerio, из них 401 использовали для построения карты генетического сцепления [19].Настоящее исследование до сих пор является единственным, которое демонстрирует менделевское наследование маркеров RAPD у рыб.

    Гуппи — самый важный вид аквариумных рыб, выращиваемых в Сингапуре, и в настоящее время выведено множество различных цветовых разновидностей [9]. Предварительные работы на некоторых разновидностях гуппи показали, что с помощью подходящих произвольных праймеров можно выявить внутри- и межсортовую генетическую изменчивость [6, 7]. В этом исследовании RAPD-фингерпринтинг использовался для анализа геномных полиморфизмов у двух разновидностей гуппи.Наследование маркеров RAPD в потомстве F 1 от однопарных скрещиваний между двумя разновидностями гуппи было изучено, поскольку жизненно важно продемонстрировать, что маркеры RAPD следуют менделевскому типу наследования, прежде чем их можно будет использовать для построения карты генетического сцепления для гуппи.

    МАТЕРИАЛЫ И МЕТОДЫ

    Генетический материал

    Были получены случайные образцы двух разновидностей гуппи, Green Snakeskin (GSS) и ¾Black (¾B), которые содержатся как отдельные поголовья на ферме в Сингапуре.Геномную ДНК из отдельных целых рыб экстрагировали по методу Dinesh et al. [7] от 30 особей каждой из разновидностей GSS и ¾B. Три однопарных скрещивания самцов GSS с самками ¾B помещали в отдельные стеклянные емкости. F 1 выводков от каждого скрещивания были отделены от родителей и выращены в течение одного месяца. Для каждого скрещивания ДНК выделяли от обоих родителей, а также от двух самцов и двух самок одномесячного потомства F 1 .

    Праймеры RAPD и их парные комбинации

    Были протестированы три отдельных олигонуклеотидных праймера: S11D6 (TTGCGTCCA, 9-мер), S10D5 (AGGTCACTGA, 10-мер) и S3D2 (AATCGGGTCG, 10-мер) с содержанием G+C 50–60%.Три парные комбинации этих отдельных праймеров были приготовлены путем смешивания равных количеств любых двух из них. Эти RAPD-праймеры оценивали, используя их для создания RAPD-профилей ДНК одной гуппи GSS. Единственный праймер, S3D2, использовали для создания профилей RAPD в последующих экспериментах.

    Условия амплификации RAPD

    Реакционная смесь для ПЦР состояла из 1 мкг матрицы геномной ДНК, 1 мкМ одиночного праймера или парной комбинации, 1X ПЦР-буфера, 1,5 мМ MgCl 2 , 200 мкМ каждого dNTP и 2 единиц ДНК-полимеразы Taq. (Promega) общим объемом 50 мк л.На конечную реакционную смесь наносили 40 мкл л минерального масла. Амплификацию проводили в системе GeneAmp PCR System 9600 (Perkin-Elmer Cetus, США) с температурным профилем низкой жесткости: 94°С в течение 3 мин, 30°С в течение 3 мин и 72°С в течение 2 мин. Всего было проведено 30 циклов с конечной достройкой при 72°С в течение 10 мин. Каждый образец 10 мкл мкл продуктов амплифицированной ДНК смешивали с 2 мкл мкл густого красителя для ПЦР, состоящего из 50 мМ ЭДТА, 30% глицерина, 0,25% ксилолцианола и 0.25% бромфеноловый синий для электрофореза. Амплифицированные продукты разделяли с помощью гель-электрофореза Urea-SDS-PAGE, адаптированного из Dinesh et al. [6]. Образцы наносили на 3% стэкинг и 10% разделяющие полиакриламидные пластинчатые гели толщиной 0,50 или 0,75 мм. Электрофорез проводили при 100 В в течение 3,5 ч на электрофорезной установке Mini-Protean II (Bio-Rad, США) или 12 ч на установке Sturdier SE 400 (Hoefer, США). Гели окрашивали нитратом серебра и фотографировали в освещенном флуоресцентном свете с помощью камеры Nikon F-501, оснащенной объективом 55 мм f2.8 Micro-Nikkor и пленка Kodak TMAX 100.

    Анализ данных RAPD

    Значения генетического сходства (SI) между профилями RAPD любых двух человек на одном и том же геле были рассчитаны по маркерам RAPD, подсчитанным вручную тремя людьми на основе наличия или отсутствия полос одинакового молекулярного размера по методу Нея и Ли [18]. Маркеры RAPD, не идентифицированные всеми тремя людьми, считались не поддающимися оценке.

    Индекс сходства (SI)=2N AB /(N A +N B ), где N AB — общее количество полос RAPD, общих для индивидуумов A и B,

    NA и NB — общее количество полос, полученных у индивидуумов A и B соответственно.

    Значения SI находятся в диапазоне от 0 до 1. Когда SI=1,0, два профиля ДНК идентичны, а когда SI=0,0, между двумя профилями нет общих полос. Мы использовали Bioprofil (Bio-1D), устройство видеокамеры с заряженной парой (ПЗС) (Vilber Lourmat, Франция), для встречной проверки и подтверждения молекулярной массы фрагментов RAPD. Следующие обозначения использовались для идентификации полос RAPD: C относится к обычным, неполиморфным полосам, которые являются общими для всех особей в разновидности или семействе; P обозначает полиморфную полосу, которая присутствует только у некоторых особей разновидности или семейства; и BP используется для маркера RAPD, присутствующего в большинстве разновидностей ¾B, но отсутствующего в GSS.

    РЕЗУЛЬТАТЫ

    Профили ДНК, полученные с помощью праймеров RAPD и их парных комбинаций

    Согласованные и воспроизводимые профили ДНК были получены из трех праймеров и их парных комбинаций (рис. 1). Продукты RAPD размером менее 2,3 т.п.н. разрешались адекватно. Среди одиночных праймеров два 10-мера, S3D2 и S10D5, давали профили ДНК с большим количеством полос, чем 9-мер, S11D6 (таблица 1). Паттерны полос, полученные с помощью комбинации двух праймеров, отличались от таковых, полученных с помощью соответствующих одиночных праймеров.Они были более сложными, с большим количеством полос с более низкой молекулярной массой, а также с «второстепенными» полосами. Этот результат ожидается, поскольку среднее расстояние между сайтами праймирования в ДНК-матрице, вероятно, будет меньше при использовании двух олигонуклеотидных праймеров, чем при наличии только одного праймера [21]. Единственный 10-мер, S3D2, использовали для последующих экспериментов, поскольку он давал наиболее поддающиеся оценке полосы (14).

    Рис. 1

    Профили RAPD одного самца гуппи GSS, полученные с помощью трех отдельных праймеров и их парных комбинаций.Продукты ПЦР разделяли в геле Urea-SDS-PAGE и визуализировали окрашиванием серебром. дорожки 1 и 2 = праймеры S3D2+S10D5; дорожки 3 и 4 = S3D2+S11D6; дорожки 5 и 6 = S10D5 + S11D6; дорожка 7 = отрицательный контроль; дорожки 8, 9 и 10 = отдельные праймеры S3D2, S10D5 и S11D6 соответственно; дорожка 11 = маркеры Lambda BstE II (п.н.).

    * представляет собой праймер S3D2 (дорожка 8), который использовали для снятия отпечатков пальцев в последующих экспериментах в этом исследовании.

    Таблица 1

    Отдельные праймеры и парные комбинации праймеров, используемые для создания профилей RAPD из ДНК одной гуппи (см.1)

    Внутри- и межсортовые полиморфизмы

    Полиморфизм ДНК выявляется по наличию полосы по сравнению с ее отсутствием и может быть вызван невозможностью праймирования сайта у некоторых людей из-за различий в нуклеотидной последовательности или вставок или делеций между сайтами праймирования [4]. Неполиморфный или мономорфный относится к маркеру ДНК, который присутствует у всех людей в образце. На рис. 2 показаны RAPD-отпечатки восьми самцов разновидности GSS, полученные с помощью праймера S3D2.У них было шесть общих неполиморфных полос (C1–C5 и C7) (таблица 2). Восемь самцов GSS, за исключением двух особей (рис. 2, дорожки 7 и 8), можно было отличить друг от друга по крайней мере по пяти поддающимся оценке полиморфным полосам (P1–P5). Высокая степень сходства между профилями RAPD лиц 7 и 8 (SI = 0,98) может свидетельствовать об их близком родстве. Значения SI, полученные путем попарного сравнения профилей RAPD любых двух лиц GSS на рисунке 2, варьировались от 0,60 до 0,98 со средним значением 0.78 ± 0,104 (табл. 3). Высокие значения SI указывали на низкую генетическую изменчивость среди особей разновидности GSS.

    Рис. 2

    Профили ДНК восьми самцов гуппи GSS (дорожки 2–9), созданные 10-мерным S3D2 (AAT CGGGTCG). Дорожка 1 = отрицательный контроль и дорожка 10 = маркеры Lambda BstE II. Было идентифицировано не менее шести поддающихся оценке неполиморфных полос, то есть присутствующих у всех людей, C1–C5 и C7 (стрелка), и пяти явно полиморфных полос (присутствующих только у некоторых людей), P1–P5 (треугольник).

    Таблица 2

    Сводка полос RAPD, идентифицированных в профилях ДНК людей на рис. от 2 до 6

    Таблица 3

    Значения индекса генетического сходства (SI), рассчитанные для гуппи Green Snakeskin (GSS) путем попарного сравнения восьми особей с использованием метода Nei и Li [18], (см. рис. 2)

    На рис. 3 показаны RAPD-профили пяти самцов GSS (эти особи отличались от GSS на рис. 2) и четырех самцов разновидности ¾B.Эти девять человек имели шесть общих неполиморфных полос (C1–C5 и C7). Эти неполиморфные полосы могут быть полезны для идентификации на уровне видов. Полоса RAPD, обозначенная как P1 на рисунке 2, присутствовала у всех людей на рисунке 3. Полоса P2 была полиморфной как в GSS, так и в ¾B. Полоса P3 присутствовала у всех индивидуумов GSS, но была полиморфной у ¾B. Полоса P4 была полиморфной в GSS, но отсутствовала в ¾B. Полоса P5, показывающая высокую интенсивность окрашивания, присутствовала у четырех из пяти индивидуумов GSS, но присутствовала как полоса более низкой интенсивности окрашивания у всех четырех индивидуумов ¾B.Полиморфные полосы BP1 и BP2 у особей ¾B отсутствовали у гуппи GSS (рис. 3). Однако полосы BP не были специфичны для разновидности ¾B, поскольку она отсутствовала у некоторых других особей ¾B в других гелях (рис. 4 и 6).

    Рис. 3

    Профили ДНК пяти самцов GSS (дорожки 2–6) и четырех самцов ¾B (дорожки 7–10), созданные с помощью праймера S3D2. Дорожка 1 = маркеры Lambda BstE II. По крайней мере, шесть отдельных общих полос, C1–C5 и C7 (стрелка), присутствовали как у GSS, так и у людей ¾B. Кроме того, полоса P1 (треугольник) также присутствует у всех людей.P2–P5 (треугольник) — четыре полиморфные полосы в GSS и ¾B. Полосы BP1 и BP2 (треугольник с окруженной точкой), полиморфные у особей ¾B, отсутствовали в GSS.

    Рис. 4

    Крест 1: профили ДНК первого семейства, созданного с помощью праймера S3D2, состоящего из родителей (дорожка 1 = самец GSS и дорожка 2 = самка ¾B) и их потомства F 1 (дорожки 3 и 4 = самцы; дорожки 5 и 6 = самки). Дорожка 7 = отрицательный контроль и дорожка 8 = маркер Lambda BstE II. Десять отдельных общих полос, C1–C7 (стрелка) и P1, P2 и P5 (треугольник), присутствующих у обоих родителей, были унаследованы всеми четырьмя потомками F 1 .Материнская полоса BP1 (треугольник с заключенной в ней точкой) присутствовала у всех особей F 1 .

    Для оценки уровня генетической изменчивости внутри сортов GSS и ¾B (рис. 3) были проведены попарные сравнения профилей ДНК особей GSS и особей 3B (табл. 4). Значения SI для сорта GSS были высокими, в диапазоне от 0,68 до 0,92 (средний SI = 0,79 ± 0,083), а для сорта ¾B также были высокими в диапазоне от 0,68 до 0,92 (средний SI = 0,81 ± 0.083). Высокое среднее значение SI для GSS (0,79 ± 0,083) очень хорошо соответствовало среднему значению SI (0,78 ± 0,104) особей разновидности GSS, полученному из рисунка 2. Эти высокие значения SI отражали низкую генетическую изменчивость как в GSS, так и в ¾B. сорта.

    Таблица 4

    Значения индекса генетического сходства (SI), рассчитанные для сортов Green Snakeskin (GSS) и ¾Black (¾B), а также между сортами GSS и ¾B путем попарных сравнений с использованием метода Нея и Ли [18] (см.3)

    Для оценки генетической изменчивости между двумя разновидностями значения SI были рассчитаны путем попарного сравнения RAPD-профиля особи GSS с профилем особи ¾B (рис. 3). Межсортовые значения SI колебались от 0,55 до 0,85 при среднем значении 0,66 ± 0,066 (табл. 4). Таким образом, между двумя разновидностями наблюдалась большая генетическая изменчивость, чем внутри каждой из разновидностей.

    Наследование RAPD-маркеров потомством F

    1

    RAPD-отпечатки пальцев трех однопарных скрещиваний (Кросс 1, 2 и 3), каждое из которых состоит из родительского самца GSS, родительского женского пола ¾B и четырех F 1 получено потомство (два самца и две самки) (рис.4–6) (табл. 5).

    Таблица 5

    Наследование RAPD-маркеров в трех семьях однопарных скрещиваний самца Green Snakeskin (GSS) и самки ¾Black (¾B) и четырех потомков F 1 (см. рис. 4–6)

    В скрещивании 1 самец-родитель GSS, самка-родитель ¾B и четыре потомства F 1 имеют десять общих неполиморфных полос (C1–C7, P1, P2 и P5) (рис. 4). Единственная материнская полоса (BP1) скрещивания 1 была унаследована всеми четырьмя потомками F 1 , что указывает на гомозиготность этой доминантной полосы у матери ¾B этого скрещивания.

    На рис. 5 показаны родители и потомки F 1 скрещивания 2. Полосы, общие для обоих родителей (C1–C5, C7, P1 и P3), постоянно унаследовались всеми четырьмя потомками F 1 . Единственная отцовская полоса (P2) была унаследована двумя потомками F 1 . У скрещивания 2 было три материнских полосы, из которых BP1 и BP2 сегрегировали среди потомков F 1 , тогда как полоса P5 была унаследована всеми F 1 .

    Рис. 5

    Крест 2: профили ДНК второго семейства, созданные с помощью S3D2.Маркировка дорожек такая же, как на рис. 4. Восемь отдельных неполиморфных полос, C1–C5 и C7 (стрелка), а также P1 и P3, обнаруженные у обоих родителей, были унаследованы всеми четырьмя потомками F 1 . Отцовская полоса P2 (треугольник) была унаследована двумя особями F 1 . Материнские полосы, P5, присутствовали у всех потомков, в то время как материнские полосы BP1 и BP2 (треугольник с закрытой точкой) показали сегрегацию среди потомства.

    Рис. 6

    Крест 3: профили ДНК третьего семейства, созданные S3D2.Маркировка дорожек такая же, как на рис. 4. Семь общих полос, C1–C5 и C7 (стрелка) и P3 (треугольник), присутствующие у обоих родителей, были унаследованы всем потомством F 1 . Отцовские полосы P4 (треугольник) были унаследованы всем потомством, в то время как P2 сегрегировал среди F 1 . Материнские полосы P1 и P5 обособились среди F 1 .

    В кроссе 3 было семь неполиморфных полос (C1-C5, C7 и P3), общих для матери, отца и F 1 , что свидетельствует о полной пенетрантности этих доминирующих маркеров RAPD (рис.6). Из двух отцовских полос, P4 был унаследован всеми F 1 , в то время как полоса P2 показала сегрегацию среди F 1 . Материнские полосы P1 и P5 разделились среди потомства.

    Хотя размер выборки для скрещиваний был небольшим, все неполиморфные полосы (C1–C5 и C7), присутствующие в обоих родителях скрещивания, были унаследованы всеми F 1 , таким образом демонстрируя полную пенетрантность. Полиморфные отцовские и материнские полосы показали доминантный менделевский тип наследования в потомстве F 1 .Полиморфные отцовские или материнские полосы, гомозиготные у отдельных родителей, были унаследованы всем потомством F 1 , в то время как полосы, гетерозиготные у родителей, сегрегировали среди F 1 . Профили ДНК потомства F 1 всех трех скрещиваний не показали каких-либо неродительских полос.

    ОБСУЖДЕНИЕ

    Результаты показали, что метод RAPD дает согласованные и воспроизводимые маркеры ДНК в различных гелях. Комбинации праймеров потенциально могут быть использованы для увеличения количества генетических полиморфизмов на основе ДНК, которые могут быть обнаружены с помощью набора одиночных произвольных праймеров [16, 21].Различия в профилях RAPD, генерируемых парной комбинацией от соответствующих одиночных праймеров, могут быть связаны с конкуренцией между генерируемыми продуктами во время удлинения [14] или неблагоприятным присутствием шпилек в продуктах RAPD, генерируемых одиночными праймерами [22]. Таким образом, метод RAPD может быть адаптирован для получения полос различной степени сложности. Такая «адаптация отпечатков пальцев» полезна при картировании генов и генотипировании [2, 13].

    Как внутри-, так и между сортами генетические полиморфизмы легко обнаруживались, и эти RAPD-маркеры можно было использовать для идентификации отдельных гуппи, что до сих пор было невозможно, за исключением наличия известных ДНК-зондов для фингерпринтинга.Маркеры RAPD также можно использовать в качестве маркеров штаммов или разновидностей, как показано в недавнем исследовании рыбок данио [13]. Профили RAPD также можно использовать для оценки генетической изменчивости и уровней инбридинга в стаях и популяциях [10, 11]. Это особенно актуально для декоративных рыб, таких как гуппи, у которых выведено множество разновидностей, и большинство из них могут быть сильно инбредными, поскольку обычно происходят от нескольких родителей-основателей, а также прошли через многие поколения строгой селекции для желаемых декоративных признаков [9]. .В Сингапуре фермеры, выращивающие гуппи, должны выращивать 10–15 сортов, чтобы удовлетворить рыночный спрос на модные сорта, и эта практика неизбежно приводит к ограничению размера популяции для каждого сорта из-за различных экономических ограничений. Результаты этого исследования подтверждают эти ожидания, поскольку средние значения SI для сортов GSS и ¾B были высокими (0,78 ± 0,104 и 0,81 ± 0,083 соответственно), что отражает низкую генетическую изменчивость внутри каждого из этих двух сортов. Значения SI между особями двух разновидностей, как правило, были ниже, чем значения внутрисортовых значений, при этом среднее значение равнялось 0.66 ± 0,066. Это опять-таки ожидаемо, поскольку сорта GSS и ¾B имеют отчетливо различающиеся цветовые узоры, подвергшиеся многим поколениям искусственного отбора фермером по различным морфологическим признакам, особенно по цвету, и выращиваются как отдельные линии для поддержания чистоты поголовья.

    Поскольку было продемонстрировано, что RAPD-маркеры из анализа потомства F 1 трех скрещиваний демонстрируют полную пенетрантность и следуют доминантному менделевскому наследованию, многочисленные RAPD-маркеры могут быть легко получены и использованы в исследованиях родословных [8, 11, 16–17, 22] и для быстрого построения карты генетического сцепления [19].Карта сцепления может также предоставлять маркеры ДНК для определения пола, а также полосы RAPD, связанные с цветовым рисунком, устойчивостью к болезням, иммунным ответом и другими важными качественными, а также количественными признаками, и их можно использовать для отбора по сцеплению.

    Благодарности

    Поддержку этому исследованию оказал Национальный университет Сингапура.

    ССЫЛКИ

    1.

    Н. Акопьянз, Н. О. Буканов, Т. У. Вестблом, С.Кресович, и. Д. Э. Берг . 1992. Разнообразие ДНК среди клинических изолятов Helicobacter pylori, обнаруженное с помощью RAPD-фингерпринтинга на основе ПЦР. Рез. нуклеиновых кислот 20:5137–5142. Google ученый

    2.

    Г. Каэтано-Анольес, Г. Дж. Бассам и П. М. Грессхоф . 1991. Отпечатки пальцев амплификации ДНК с использованием очень коротких произвольных олигонуклеотидных праймеров. Биотехнология 9: 553–557. Google ученый

    3.

    Каэтано-Анольес 1993.Амплификация ДНК с произвольными олигонуклеотидными праймерами. Применение методов ПЦР 3:85–94. Google ученый

    4.

    А. Г. Кларк и К. М. С. Ланиган . 1993. Перспективы оценки расхождения нуклеотидов с помощью RAPDS. Мол Биол Эвол 10:1096–1111. Google ученый

    5.

    К. Р. Динеш, К. Л. Чуа, VPE Phang, Т. М. Лим и Т. В. Тан . 1993. Полиморфизмы ДНК в цветных мутантах тигрового барбуса, Barbus tetrazona, с помощью полимеразной цепной реакции с произвольным праймированием.В «Проц. Международный семинар по генетике в аквакультуре и управлении рыболовством»Под редакцией Д. Пенман, Н. Роонгратри и Б. МакЭндрю , редакторы. Стерлинг. Великобритания, стр. 125–127. Google ученый

    6.

    К. Р. Динеш, VPE Phang, Т. М. Лим, К. Л. Чуа и Т. В. Тан . Амплификация ДНК гуппи, Poecilia reticulata. В. «Протокол 3-го Азиатского форума по рыболовству» Asian Fish Soc. 26–30101992.Сингапур. под давлением. Google ученый

    7.

    К. Р. Динеш, Т. М. Лим, К. Л. Чуа, В. К. Чан и VPE Phang . 1993. Анализ RAPD: эффективный метод снятия отпечатков пальцев ДНК у рыб. Zool Sci 10: 849–854. Google ученый

    8.

    К. С. Эхт, Л. А. Эрдал и Ти Джей Маккой . 1991. Генетическая сегрегация случайной амплификации полиморфной ДНК в диплоидной культивируемой люцерне.Геном 35:84–87. Google ученый

    9.

    А. А. Фернандо и VPE Phang . 1994. Аквакультура пресноводных декоративных рыб в Сингапуре. Сингапурский политехнический. Сингапур. стр. 39–50. Google ученый

    10.

    Х. Хадрис, М. Балик и Б. Шируотер . 1992. Применение случайно амплифицированной полиморфной ДНК (RAPD) в молекулярной экологии. Мол Экол 1: 55–63. Google ученый

    11.

    Э. М. Халлерман и Дж. С. Бекманн . 1988. Полиморфизм на уровне ДНК как инструмент в науке о рыболовстве. Can J Fish Aquat Sci 45: 1075–1087. Google ученый

    12.

    Дж. Ху и CF Кирос . 1991. Идентификация сортов брокколи и цветной капусты с маркерами RAPD. Отчеты о клетках растений 10: 505–511. Google ученый

    13.

    С. Л. Джонсон, К. Н. Мидсон, Э.В. Баллинджер и Дж. Х. Постлетвейт . 1994. Идентификация праймеров RAPD, которые выявляют обширный полиморфизм между лабораторными штаммами рыбок данио. Геномика 19: 152–156. Google ученый

    14.

    Р. М. Клейн-Ланкхорст, А. Вермунт, Р. Вайде, Т. Лигарская и П. Забель . 1991. Выделение молекулярных маркеров томата (L. esculentum) с использованием случайной амплификации полиморфной ДНК (RAPD). Теория Appl Genet 83: 108–114.Google ученый

    15.

    Ю. Кубота, А. Шимада и А. Шима . 1992. Обнаружение повреждений ДНК, вызванных гамма-лучами, у деформированных доминантных летальных эмбрионов медаки японской (Oryzias latipes) с помощью AP-PCR-фингерпринтинга. Мутат Рез 283: 263–270. Google ученый

    16.

    М. Р. Микели, Р. Бова, П. Калиссано и Э. Д’Амброзио . 1993. Произвольная амплификация полиморфных ДНК-отпечатков пальцев с использованием комбинаций олигонуклеотидных праймеров.Биотехника 15: 388–389. Google ученый

    17.

    М. Мунтали, Б. В. Форд-Ллойд и Х. Дж. Ньюбери . 1992. Амплификация полиморфной ДНК для снятия отпечатков пальцев растений. Применение методов ПЦР 1:274–276. Google ученый

    18.

    М. Ней и У. Х. Ли . 1979. Математическая модель для изучения генетической изменчивости эндонуклеаз рестрикции. Proc Natl Acad Sci USA 76: 5269–5273.Google ученый

    19.

    Дж. Х. Постлетвейт, С. Л. Джонсон, К. Н. Мидсон, В. С. Талбот, М. Гейтс, Э. В. Баллинджер, Д. Африка, Р. Эндрюс, Т. Карл, Дж. С. Эйзен, С. Главная, CB Kimmel, М. Хатчинсон, М. Джонсон и А. Родригес . 1994. Карта генетического сцепления рыбок данио. Наука 264: 699–703. Google ученый

    20.

    Дж.валлийский и М. Макклелланд . 1990. Отпечатки геномов с помощью ПЦР с произвольными праймерами. Рез. нуклеиновых кислот 18:7213–7218. Google ученый

    21.

    Дж. Уэлш и М. Макклелланд . 1991. Геномная дактилоскопия с использованием произвольно праймированной ПЦР и матрицы попарных комбинаций праймеров. Рез. нуклеиновых кислот 19:5275–5279. Google ученый

    22.

    Дж. Уэлш, К. Петерсон и М. Макклелланд .1991а. Полиморфизмы, полученные в результате произвольной праймированной ПЦР у мышей: применение для идентификации штаммов и генетического картирования. Нуклеиновые кислоты Рез. 20:303–306. Google ученый

    23.

    Дж. Уэлш, Р. Дж. Ханикатт, М. Макклелланд и Б. В. С. Собрал . 1991б. Определение отцовства гибридов кукурузы с использованием полимеразной цепной реакции с произвольным праймированием (AP-PCR). Theor Appl Genet 82: 473–476. Google ученый

    24.

    Дж. Г. К. Уильямс, А. Р. Кубелик, К. Дж. Ливак, Дж. А. Рафальский и С. В. Тинги . 1990. Полиморфизмы ДНК, амплифицированные произвольными праймерами, можно использовать в качестве генетических маркеров. Рез. нуклеиновых кислот 18:6531–6535. Google ученый

    25.

    Дж. Г. К. Уильямс, М. К. Ханаффи, Дж. А. Рафальский и С. В. Тинги . 1993. Генетический анализ с использованием случайно амплифицированных маркеров полиморфной ДНК. Метод Энзимол 218:704–740.Google ученый

    26.

    Дж. М. Райт 1993. ДНК-дактилоскопия рыб. В «Биохимии и молекулярной биологии рыб, том 2». Эд автор П. В. Хочачка и Т. П. Моммзен , редакторы. Эльзевир. Амстердам. стр. 57–91. Google ученый

    ПЕЦИЛИЯ ТРЕХКОЛОРНАЯ ИЛИ ПЕЦИЛИЯ ВАРИАТУСНАЯ (XIPHOPHORUS VARIATUS)

    Пецилия трехцветная или пецилия вариатус — русскоязычная транскрипция научного названия Xiphophorus variatus, относится к семейству Poeciliidae.Наряду с близкородственной пецилией это одна из самых распространенных аквариумных рыбок. Столь высокая популярность обусловлена ​​невысокими требованиями к условиям содержания и простотой разведения. Не последнюю роль сыграли яркие цвета.

    Впервые был завезен в Европу в 1931 году. За десятилетия искусственной селекции появилось много новых сортов, в том числе гибриды с уже упомянутыми пецилиями (Xiphophorus maculatus) и меченосцами. Декоративные разновидности теперь более распространены в домашних аквариумах, чем дикие популяции с их естественной окраской.

    Среда обитания

    Первоначально считался эндемичным видом для небольших, сильно заросших водоемов на атлантическом склоне Мексики. Однако с развитием аквариумистики эти рыбки оказались в новой для себя среде обитания, где успешно прижились.

    Ареал обитания распространился на всю Центральную Америку, острова Карибского моря и южные штаты США. В настоящее время они населяют речные системы Юго-Восточной Азии, Дальнего Востока и южных районов Европы.

    Краткая информация:

    • Объем аквариума от 60 литров.
    • Температура — 20-28 °C
    • Значение PH — 7,0-8,2
    • Жесткость воды — от средней до высокой жесткости (10-30 dGH)
    • Тип основания — любой
    • Освещение — умеренное или яркое
    • Солоноватая вода допускается в концентрации 5-10 г на литр воды
    • Движение воды — умеренное
    • Размер рыбы 5-7 см.
    • Корм ​​- любой корм
    • Темперамент — миролюбивый
    • Содержание поодиночке, парой или группой

    Описание

    Взрослые особи достигают длины 5–7 см. Самцы ярче окрашены и меньше самок. Цвет и рисунок тела могут различаться в зависимости от вида. Наиболее близким к естественному окрасу считается серебристый цвет тела с многочисленными темными крапинками, красный хвост и желтый спинной плавник. Именно сочетание этих трех цветов и дало название виду.

    Питание

    Принимаются все виды сухих, замороженных и живых кормов. Предпочтение следует отдавать тем, в которых присутствуют растительные добавки.

    Наш продукт Натуральный сухой корм Aqvium для мелких и средних рыб из чистых озер Сибири и Северного Крыма в экологически чистой биоразлагаемой упаковке.

    Содержание и уход, обустройство аквариума

    Считаются неприхотливыми и выносливыми видами. Пецилия трехцветная способна жить в отстоянной водопроводной воде при условии, что она имеет значения жесткости от средних до высоких (индекс dH).В регионах с мягкой водой придется прибегать к специальным реагентам, повышающим жесткость. Подобные вещества можно найти в ближайшем зоомагазине или заказать в Интернете.

    В просторном, малонаселенном аквариуме (например, 100 л на 2-3 рыбки) допустимо не применять систему фильтрации или использовать простой эрлифтный фильтр при условии регулярного обслуживания и еженедельной замены части вода с пресной.

    Дизайн произвольный. Подбирается на усмотрение аквариумиста.Тем не менее, есть одно важное условие – необходимо предусмотреть достаточное количество укрытий. Живые водные растения и натуральные коряги — хороший выбор.

    Поведение и совместимость

    Миролюбивый дружелюбный вид, способный ужиться со всеми видами рыб сопоставимого размера и темперамента. Рекомендуется приобретать в группе из нескольких самцов и самок, причем последних должно быть больше.

    Размножение/размножение

    В благоприятных условиях нерест происходит регулярно с периодичностью 1 раз в 1-2 месяца.Как и другие живородящие виды, Pecilia tricolor не откладывает икру, а рождает полностью сформировавшихся мальков. Родители не отличаются заботой о своем потомстве, поэтому во избежание хищничества молодь целесообразно отсадить в отдельную емкость.

    Добавить комментарий

    Ваш адрес email не будет опубликован.