Содержание

Домашний зоопарк

Если вы не можете держать в доме кошку или собаку, но хотите общаться с живым существом, заведите себе хомячка, который доставит массу удовольствия в часы досуга, станет вашим другом.

Впервые небольшая колония этих хомячков была обнаружена в Сирии, отсюда их название. Длина тела до 15 см, окрас — розовый, рыжий, чёрный, белый; выведены хомячки с длинной шерстью. Это удивительно привлекательное и озорное животное не требует сложного ухода, заботы о нём посильны даже дошкольнику. Зверьки быстро привыкают к людям. Наиболее ручными хомячки становятся тогда, когда они живут по одному: не убегают, когда их выпускают из клетки, спокойно сидят на ладони, берут пищу из рук.

Содержать хомячков лучше всего в  клетках (зоомагазины предлагают большой ассортимент различных клеток для грызунов). Лучшая подстилка — древесная стружка или опилки, можно использовать и бумагу, но её надо чаще менять. Для гнезда можно использовать глиняный горшок с отверстием сбоку, чтобы зверёк мог свободно входить и выходить. Пластмассовые и деревянные домики хомяки активно грызут. Для обустройства гнезда хомячку можно положить мягкое сено, сухие листья. Вблизи своего гнезда хомячки делают кладовку, куда складывают запасы пищи. В гнезде и кладовке хомячков уборку желательно производить не чаще 1 раза в неделю. Хомячки очень чистоплотны, их можно приучить ходить в туалет в подходящую по размеру баночку. Её достаточно регулярно мыть.

Хомячки хорошо едят зерновую смесь (овсянка, пшеница, дроблёная кукуруза, нежареное семя подсолнечника), сухарики из белого и чёрного хлеба, овощи, фрукты, зелень и нуждаются в небольших количествах белковой пищи (творог, яйцо). В качестве подкормки нужно давать кусочки мела. Пища  должна быть разнообразной и свежей, испорченный корм легко вызывает нарушение пищеварения. Обычно хомячкам бывает достаточно влаги, содержащейся в сочных кормах. Можно использовать готовые кормовые смеси, предлагаемые зоомагазинами.

Для получения здорового потомства первый раз ссаживать самку с самцом следует в 2-3 месячном возрасте.

Беременность длится около 2 недель, хомячки рождаются слепыми и голыми в количестве 3-12 голов. Во время выкармливания потомства не рекомендуется чистить гнездо и брать детёнышей  в руки, так как самка из-за беспокойства может их уничтожить. Через 21 день после родов самку отсаживают от молодняка. Самца лучше отсадить от самки ещё перед родами.

Хомячки — животные очень доверчивые, и после привыкания их можно выпускать побегать по полу (если в комнате нет щелей). Но содержать хомячка на свободе (без клетки) нельзя: он может погрызть мебель, вещи, попасть под ноги, погибнуть от несчастного случая. Нельзя оставлять хомячка без присмотра на высоких предметах, на подоконнике, на балконе, так как он не чувствует опасности падения с высоты и может травмироваться или разбиться.

Хомяк. Содержание, уход и кормление хомячков.

Хомяки, особенно сирийский золотистый хомяк (Mesocricetus auratus), а также некоторые виды карликовых хомяков (например, китайский полосатый хомяк, джунгарский карликовый хомяк) хотя и являются самыми популярными, не совсем подходят для детей в качестве домашних животных из за своей ночной активности.

Анатомические и физиологические особенности хомяков

С 1930 года было выведено несколько пород золотистого хомяка различной окраски и типа шерстного покрова (также и длинношерстный, так называемый «хомяк Тедди»).

В своих защечных карманах хомяк переносит корм в укромный уголок, где спокойно поедает. Перетаскивание детенышей также осуществляется в этих защечных мешках.

С двух сторон по бокам у хомяка имеются черноокрашенные пахучие железы, служащие для маркировки территории, и их не следует принимать за опухоли или кожные изменения.

При овуляции у самок из влагалища выделяется слизь, которая часто принимается неопытным владельцем за гной.

Моча в норме густая, желтоватая и содержит кристаллы, pH находится на уровне 8.

  • Вес тела: 150—180 г (золотистый хомяк), 30—50 г (карликовые хомяки).
  • Температура тела: 37-38°С.
  • Дыхание: 45—150 дыхательных движений в минуту.
  • Пульс: 250—560 ударов в минуту (у карликовых хомяков — 500—600). Половозрелость: 35-45 дней (золотистый хомяк), 14-28 дней (карликовые хомяки).
  • Частота течки и длительность цикла: круглогодично с длительностью цикла около 4 дней. После родов новый цикл начинается уже через 6—15 часов.
  • Беременность: 15-16 дней (золотистый хомяк), 19-22 дня (карликовый хомяк).
  • Возраст отъема: 20—25 дней (золотистый хомяк), 15 дней (карликовый хомяк).

Содержание, уход и кормление хомячков

Клетка должна быть сделана из легко чистящегося искусственного материала с нержавеющей решеткой. Величина (длина-ширина-высота) должна быть в среднем 50 х 30 х 35 см. Деревянный или пластмассовый домик с маленьким лазом (диаметр около 5 см) подходит как укрытие и спальня, беличье колесо заменяет фитнес и тем служит на пользу животному.

Толстый слой подстилки из непылящего материала типа тонкой древесной стружки, целлюлозы или грубых опилок будет с удовольствием использован в убежище. Бумажные трубочки и приспособления для лазания очень нравятся хомякам.

Температурные колебания и сквозняки переносятся очень плохо. При температуре ниже 5°С, а также при коротком световом дне или недостаточности корма хомяки впадают в коматозное состояние (псевдозимний сон).

В день хомяку нужно 15—20 г корма. Он должен содержать в среднем 16% сырого протеина, 60—65% углеводов, 4—5% жира. Наряду с комбикормом (имеющиеся в продаже готовые смеси) в качестве сочного корма походят трава, львиный зев, салат, капуста, морковь, огурцы, яблоки и др. Собирать зелень самостоятельно следует в экологически чистых местах (не вдоль дорог или насыпей), хорошо промывать и просушивать (сырой кори быстро плесневеет и может вызвать проблемы с пищеварением). Дополнительно можно давать сухой хлеб, все виды зерна, подсолнечные и тыквенные семечки, орехи, веточки (например, фруктовая древесина), печенье для собак, для удовлетворения потребности в белке — молоко, мясо, печень, рыбу, мучных червей и вареные яйца. Синдром белковой недостаточности проявляется в слабости, атрофии мышц и исхудании.

Кормовой склад (обычно внутри домика) необходимо регулярно проверять и удалять скоропортящиеся продукты.

Питьевая вода (около 20 мл на 100 г веса тела) должна быть в бутылочке. Постоянно следить за чистотой трубочки. Животное может страдать от жажды перед полной, но грязной бутылкой!

Искусственное вскармливание можно осуществлять детским питанием (фрукты, зелень, мясо), добавив мед, сироп и растительное масло. Калорийность корма должна быть около 30—35 ккал на 100 г веса тела; у щенных, кормящих и сильно лихорадящих животных — 70 ккал на 100 г веса тела.

Хомяки — одиночные животные. При наличии некоторого терпения можно легко приручить и самца и самку, причем самцы общительнее. При неправильном уходе, закармливании лакомствами, не-сбалансированном кормлении, при болезнях, частых стрессах и неправильном обхождении возможно появление агрессивного поведения, кусачести и каннибализма. Животное, активное по ночам, спит весь день и просыпается только когда его беспокоят или вынимают из клетки.

Поэтому подсосных матерей и малышей в первые 10 дней после рождения следует как можно меньше беспокоить и ни в коем случае не брать в руки!

Избыточный вес у хомяков

Чрезмерный вес ведет к усилению проблем кровообращения особенно при экстремальных перепадах температуры, уменьшает плодовитость.

Мероприятия: медленное снижение веса за счет уменьшения количества комбикорма, низкокалорийные лакомства (без сахара, жира — см. состав на упаковке). Предоставить возможность активного движения, например, в специальных пластмассовых колесах для бега.

Старение хомяков

С 15 месяцев жизни начинаются старческие проявления в виде проблем с работой сердца и зубами, болезней почек и печени. Среди прочего симптоматически проявляются в виде взъерошенного шерстного покрова, обезвоживания, склеивающихся век и расстройства вестибулярного аппарата. Терапевтически можно облегчить отдельные симптомы правильным питанием, достаточным обеспечением витаминами.

Каннибализм у хомяков

Поедание собственного потомства чаще происходит у очень молодых и неопытных самок. Причиной тому становится пренебрежительное отношение, неудовлетворительное содержание и кормление (недостаток белка и витамина Е), болезни, стресс, беспокойство самок от 48 часов до 10 дней после родов, взятие детенышей в руки до 10 дней жизни, неудачное расположение и величина гнезда.

Для предотвращения надо исключить все вышеперечисленные факторы. Дополнительно необходимо предоставить достаточное количество мягкой материи для гнезда. Клетку не стоит чистить незадолго до родов и неделю после; должно быть достаточно воды и сухой подстилки.

внешний вид, характер, особенности ухода и содержания

Сирийские хомяки – небольшие грызуны с округлыми ушами, черными глазками-бусинками и едва заметным хвостиком. Благодаря миниатюрным размерам, общительности и забавным повадкам их часто заводят в качестве домашних питомцев. А чтобы обеспечить зверькам комфортные условия, перед их приобретением лучше заранее побольше разузнать о сирийских хомяках.

Описание животного

Родиной данной породы считается Сирия. В XX столетии эти зверьки были завезены в Европу и быстро стали популярными среди любителей декоративных питомцев.

За необычный цвет шубки и симпатичную внешность грызун получил несколько альтернативных наименований. Его часто называют хомяк золотой, уссурийский или персидский, а с недавних пор за ним закрепилось шутливое прозвище медвежонок Тэдди.

Внешний вид

Сирийские хомяки имеют относительно крупные размеры. Эти грызуны отличаются крепким телосложением и вырастают до 12-20 см в длину. Самец имеет массу до 200 г, самка весит в пределах 120-140 г.

Выглядит сирийский хомяк следующим образом:

  • мордочка круглая, с крупными защечными мешками;
  • глаза большие, блестящие, темные;
  • уши маленькие, закругленные, поросшие коротким мехом;
  • носовая часть обрамлена длинными усами;
  • тело короткое, крепко сбитое;
  • лапки миниатюрные;
  • хвост короткий, практически незаметный;
  • запаховые железы локализованы на боках и напоминают скопление шершавых родинок.

На заметку. Эти грызуны отличаются специфическим строением конечностей. На передних лапах сирийских хомяков имеется по 4 пальца, на задних – по 5.

В зависимости от типа шерстного покрова золотистый хомячок делится на следующие виды:

  1. Короткошерстный с классической шубкой, характерной многим грызунам.
  2. Длинношерстный с густым мехом, длина которого может достигать 10 см. Такие золотистые хомяки имеют забавный вид, но их шерсть быстро загрязняется.
  3. Рекс с плотной курчавой шубкой, похожей на овечье руно. Такие зверьки были выведены совсем недавно и сильно выделяются на фоне своих собратьев.
  4. Сатиновый с красивой блестящей шубкой. Золотистых хомяков этого типа легко спутать с короткошерстными особями.

Разновидности окрасов

Большинство представителей данной разновидности имеют золотистый цвет шерсти. Но их окрас может быть и другим. Среди сирийских хомяков распространены следующие оттенки:

  • белый;
  • кремовый;
  • коричневый;
  • дымчатый;
  • черный;
  • рыжий;
  • темно-серый.

Интересно! Во Франции случайно вывели сирийского хомяка с черно-пепельным мехом. Такой грызун считается большой редкостью и не встречается в дикой природе.

Расцветка зверьков может быть и однородной, и пятнистой. Среди сирийских хомяков часто встречается окрас «блондин». Для получения особей с этой расцветкой использовались белые и желтые зверьки.

Грызуны с такой шубкой отличаются неоднородной окраской. У корней их шерсть светло-серая, а верхняя часть волосков имеет плавный переход от белоснежного к кремовому. Белый сирийский хомяк сильно отличается от своих сородичей. Зверек имеет аккуратные серые ушки, белоснежную шубку и красные глаза.

Характер и повадки

Сирийский хомяк ведет ночной образ жизни. В светлое время суток грызун в основном спит, а просыпается только чтобы поесть. Зато после наступления темноты зверек начинает активничать. Ночью золотистый хомяк обустраивает жилище, запасается провизией, резвится и играет.

На заметку. Живущие в дикой природе сирийские хомяки постоянно копают грунт. Они способны вырыть нелимитированное количество нор и подземных ходов.

Зверек ведет обособленную жизнь и нуждается в личном пространстве. Молодняк сбивается в небольшие группы, которые распадаются как только грызуны достигнут половой зрелости.

Здоровье и продолжительность жизни

И дикие, и домашние сирийские хомяки живут не дольше 3 лет. При надлежащем уходе и сбалансированном питании этот срок можно продлить, правда, несущественно.

У сирийского хомяка отмечается предрасположенность к следующим заболеваниям:

  • нарывы;
  • трихомоноз;
  • конъюнктивит;
  • болезнь Ауески;
  • кишечная палочка;
  • герпес;
  • ожирение;
  • облысение;
  • проблемы с зубами;
  • «мокрый» хвост.

Уход и содержание

Золотистый сирийский хомяк – неприхотливый и чистоплотный зверек, которому не требуется специальный уход. Чтобы грызун дольше сохранял здоровье и игривость, ему необходима просторная клетка и хорошо сбалансированное питание.

Клетка и наполнитель

Для содержания сирийского хомяка в домашних условиях нужна просторная клетка с цельным пластиковым поддоном и часто расположенными металлическими прутьями. Оптимальный размер жилища составляет 40 x 60 см.

Дно клетки рекомендуется засыпать кукурузным наполнителем или хвойными опилками, которые впитывают влагу и неприятные запахи. А внутри нужно обязательно установить ванночку с песком, минеральный камень, поилку и кормушку.

Чтобы хомячок не скучал и не заболел ожирением, для него устанавливают несколько игровых элементов в виде специального колеса, лесенок и разнообразных туннелей. Чем больше гимнастических снарядов будет в клетке зверька, тем активнее он будет.

Гигиена

Сирийские хомячки – очень чистоплотные грызуны. Они самостоятельно ухаживают за своей шубкой и не нуждаются в специальных гигиенических процедурах. Хозяину необходимо позаботиться только о поддержании чистоты их жилища.

Раз в неделю клетку сирийского хомяка подвергают генеральной уборке. Для этого с нее снимают верхнюю часть и выгребают с поддона наполнитель с остатками корма. Затем клетку дезинфицируют при помощи безопасных средств и насухо вытирают бумажными салфетками или хлопчатобумажной тканью. Точно так же обрабатывают все игровые элементы, а поилку и кормушку обдают кипятком.

Важно! Сирийский (сицилийский) хомяк плохо переносит водные процедуры. Зверек легко простужается и впадает в стрессовое состояние. Поэтому купать грызуна не рекомендуется.

Приручение

Золотистый хомяк – неагрессивный и послушный зверек. Он хорошо поддается обучению, легко идет на контакт с людьми и быстро привыкает к рукам.

Чтобы иранский или сирийский хомячок научился доверять человеку, нужно соблюдать несколько простых рекомендаций:

  • не беспокоить питомца в дневное время;
  • не прикасаться к голове зверька;
  • не удерживать хомячка на руках против его воли;
  • не перемещать клетку с питомцем в шумное помещение.

Чтобы сирийский (персидский) хомячок быстрее привык к голосу хозяев, с ним почаще разговаривают спокойным тоном.

Важно! Взрослый золотистый хомяк хуже поддается приручению, поэтому устанавливать контакт с питомцем нужно как можно раньше.

Особенности кормления

Золотистые хомяки – всеядные грызуны, которые могут питаться и животными, и растительными кормами. В дикой природе в рационе этих зверьков присутствуют мелкие насекомые, муравьи, личинки, сочные фрукты, коренья, зелень, ягоды и семена.

В домашних условиях кормить сирийского хомяка лучше готовыми сухими смесями из зоомагазина. Важно смотреть, чтобы в их составе было до 23 % белка, не больше 6 % жиров и около 10 % клетчатки.

Категорически запрещается кормить сирийских хомячков сладостями, соленьями, цитрусовыми, капустой, молоком и кисломолочными продуктами.

Чтобы грызун стачивал резцы, ему рекомендуется давать ветви плодовых деревьев, кабачки, репу, морковь и яблоки.

Разведение

Золотистые хомяки отличаются высокой плодовитостью. Эти грызуны способны приносить по 3-5 пометов за год. Самка сирийского хомяка готова к продолжению рода с 4-месячного возраста. Самец становится половозрелым в 3 месяца.

Для успешного оплодотворения мальчик и девочка помещаются в просторную клетку и живут там какое-то время. После спаривания зверьков расселяют, поскольку беременные самки становятся весьма агрессивными.

Спустя 18 суток с момента оплодотворения на свет появляются от 4 до 15 детенышей. До 30-дневного возраста малыши питаются исключительно материнским молоком, а приблизительно в 37 дней их уже можно отселять в другую клетку.

Важно! Клетку с матерью и потомством желательно поставить в тихое темное место. А самих новорожденных нельзя трогать руками. В ином случае самка уловит чужой запах и может съесть детенышей.

Хомяки сирийские – очаровательные грызуны с приятной внешностью и общительным игривым нравом. Они непривередливы в питании и не требуют сложного ухода. При правильном обращении симпатичные зверьки станут неиссякаемым источником позитива.

Фотообзор

Видео по теме

Мне нравится2Не нравится

Глазная патология у хомяка, описание клинического случая

В клинику «Свой Доктор» филиал Бирюлево, на плановый прием к врачу офтальмологу в условиях отделения клиники по Экзотическим животным поступил сирийский хомяк, по кличке Тёма в возрасте 2-х лет.

Со слов владельцев: в течении длительного времени были проблемы с правым глазом, ранее с хомяком обращались в другие клиники, однако последующее лечение не давало положительного результата. В течении почти 1 года животное постоянно испытывало сильный дискомфорт и болезненности из-за сильного сдавливания глаза опухолью.

На сегодняшний день в ветеринарной офтальмологической литературе описано мало глазных патологий у хомяков, чаще встречаются лишь единичные клинические исследования отдельных глазных патологий. Так же не описана и статистика встречаемости опухолевых поражений глазных структур. Данный опыт действительно, по-своему можно назвать уникальным и довольно сложным клиническим случаем. Однако, мы не опустили руки и решили эту не легкую интересную задачу.

При офтальмологическом обследовании было установлено, что у животного есть новообразование, которое находится под нижним веком правого глаза, условный размер 3-4 мм в диаметре, новообразование сильно смещает глазное яблоко, механически раздражает роговицу, из-за этого болевого состояния глаз постоянно закрыт и не может выполнять свою функцию.

После оценки анестезиологических рисков и оценки функции работы органов и систем органов, была проведена плановая операции по удалению опухоли с последующим гистологическим исследованием.

При совместной работе двух отделений клиники: по экзотическим животным и офтальмологии, новообразование было удалено хирургически, с последующей отправкой в лабораторию для дальнейшего исследования опухоли.

Сейчас хомяк  Тёма  чувствует себя хорошо, —  уже сразу после операции, животное проявляло активность. На сегодняшний день глаз полностью выполняет свою функцию, и животное больше не испытывает дискомфорт.

 Миронович Артем Олегович – ветеринарный врач офтальмолог.

Врач для игуаны

Гость очередного номера  «Коммунара» — Максим Дьяченко, известный в Уссурийске и Приморском крае специалист по экзотическим животным.

В ветеринарную клинику доктора Дьяченко приносят птиц, грызунов, рептилий, редких животных. И там всегда стараются помочь.

Работы у экзотолога немало, поэтому свободное время для разговора выкроить удалось лишь в субботу вечером. В клинике уже было пусто, где-то за дверью скучала проходящая лечение игуана, а из пластиковой коробки возле рабочего стола дружелюбно глядел паук-тарантул.

— Паука мне подарили, — рассказал доктор. — Кстати, оказался идеальным питомцем для занятого человека. Очень неприхотливый и симпатичный. Он слегка ядовит, но не кусается, разве что аллергическая реакция может возникнуть на его волоски.

Экзотические животные не такая уж и редкость. Практически каждый день на приемах попугаи, кролики, крыски, морские свинки, черепахи. Максима Юрьевича рекомендуют покупателям заводчики, зоомагазины, ветеринары других клиник.

Семь лет назад, когда доктор Дьяченко начал свою работу, подобных врачей практически не было. Бытовало мнение, что проще и дешевле завести новое здоровое животное, чем лечить заболевшее. Но некоторые хозяева были готовы на все, чтобы продлить жизнь своему питомцу.

— Моя работа — это не про экономическую эффективность, а про любовь, — говорит Максим. — Бывают случаи, когда приходит мужчина, с виду айсберг, воплощение брутальности, разжимает кулак, а там — мелочь какая-нибудь, хомячок-джунгарик или волнистый попугайчик. И просит чуть ли не со слезами на глазах: «Доктор, спасите». Если учесть, что срок жизни хомяка или крыски два-три года, то мы, к примеру, удаляем опухоли и продляем их жизнь всего на несколько месяцев.

Неопытным хозяевам часто кажется, что у их зверюшек нет никаких проблем со здоровьем. А это не так. Основные и частые болезни грызунов — стоматологические и гастроэнтерологические. В клинике есть специальный стоматологический стол, где я делаю коррекцию зубов морским свинкам, кроликам, шиншиллам.

Если вы заводите себе птицу, ей необходимо общение, интеллектуальные игры. В природе попугаи постоянно изобретают способы добыть пропитание, и чем шире «продуктовая корзина» птицы, тем выше ее интеллект. А без этого занятия она скучает и от стресса начинает выщипывать себе перья. Кроме того, птицам просто жизненно необходимо летать, иначе от недостатка циркуляции воздуха в легких возникают респираторные проблемы. А вот с волнистым попугайчиком по-другому, ему достаточно свободных полетов по квартире, чтобы «проветрить» дыхательную систему.

— А есть питомцы, которые не требуют особого ухода? Черепахи, ящерицы…

— Их болезни как раз связаны с недостатком культуры содержания рептилий в нашей стране. Например, игуаны активно входят в моду, но люди не всегда четко представляют себе, что эти рептилии — жители тропиков, которым необходимо создать уголок с повышенной влажностью и температурой.

Или еще одна проблема. Каждое лето в Андреевке, на рынках и не только, массово предлагают с рук красноухих черепах. Их продают маленькими, когда они очень яркие, забавные, но никто не объясняет, что им нужен особый уход. Они вырастают и становятся блеклыми, крупными и требуют больших аквариумов, ультрафиолетовых ламп, правильного рациона. Поэтому черепах зачастую выпускают «на волю», как, например, случилось в Москве, где некоторые парки оказались заполнены выброшенными на произвол судьбы рептилиями. Обычны ситуации, когда черепаха, которая должна жить в воде, бегает по ковру дома, а сухопутная зимует под батареей, где высыхает и сильно обезвоживается. Очень страдают они и от отсутствия ультрафиолета, света из окон для них недостаточно, в итоге кальций не усваивается и панцирь с костями становятся мягкими. В итоге их полуживых приносят в клинику и говорят: «А продавец уверял, что черепашка совсем не требует ухода».

— А какие еще необычные питомцы вам попадаются?

— Ну, например, люди стали заводить ежиков. Это очень милые создания, но только когда с ними занимаются, уделяют время. Иначе «колючка» не станет стремиться к общению, просто будет жить своей жизнью где-то под столом. К сожалению, ежи — достаточно тяжелые питомцы, склонные к онкологии.

Раньше были очень популярны хорьки, но выяснилось, что они обладают отменным здоровьем только в первые три года жизни, затем обрастают хроническими заболеваниями, требующими регулярных визитов к врачу. Сейчас остались только настоящие ценители хорьков, которые тщательно следят за их самочувствием. Сурикаты стали появляться в квартирах, соболи. Было время, брали енотов, но после того, как они разгромили несколько домов, интерес к ним резко уменьшился. Очень шкодливые зверьки.

— К вам попадают только домашние звери и птицы?

— Бывает, люди подбирают голубей и приносят на лечение. Обычный человек вряд ли заметит в городской суете больную птицу. А есть те, кто их видит, оплачивает лечение, к примеру, по починке крыла, затем после выздоровления выпускает. Думаю, что в

Приморском крае только моя клиника принимает голубей, потому что для меня нет понятия «мусорные» или «помоечные» птицы.
Приносят и сов, подобранных на трассах. Сейчас у моего ассистента живет сова, мы лечим ей крыло и ждем момента, когда ее можно будет выпустить на волю.

Существует специальный проект «Раненое небо», в рамках которого мы лечим диких птиц. Привозили в клинику аиста, цаплю. Дикой утке недавно ампутировали крыло, и неравнодушный человек забрал ее жить к себе. Завтра ворон приедет лечиться.

— Много ли специалистов-экзотологов в Приморье?

— Именно специалистов мало. И каждый из них «вечный студент», который постоянно повышает свою квалификацию, проходит учебу по разным специальностям. Все курсы совсем недешевы, так же, как и оборудование. Статьи в основном выходят на английском языке.

За границей это направление развито, к вопросам лечения экзотических животных подходят основательно. Из российских источников нам очень помогает опыт врачей Московского зоопарка.

Оксана СЕЗИК.
Фото автора.

Класс млекопитающие / КонсультантПлюс

КЛАСС МЛЕКОПИТАЮЩИЕ

Отряд Насекомоядные

Белозубка малая (малютка)

Бурозубка гигантская

Erinaceus (Hemiechinus) auritus

Кутора Шелковникова

Обыкновенная кутора

Могера японская

Отряд Рукокрылые

Вечерница гигантская

Вечерница малая

Длиннокрыл обыкновенный

Кожанок Бобринского

Кожанок северный

Араксинская ночница Шауби

Армянская ночница

Ночница Бехштейна

Ночница Брандта

Ночница Иконникова

Ночница Наттерера

Ночница остроухая

Ночница прудовая

Ночница трехцветная

Ночница усатая

Подковонос большой

Rhinolophus ferrumequinum

Бухарский подковонос

Подковонос малый

Подковонос Мегели

Средиземорский подковонос Блази

Южный подковонос

Складчатогуб широкоухий

Стрелоух белобрюхий

Широкоушка азиатская

Широкоушка европейская

Отряд Грызуны

Армянская полевка

Бобр речной (западносибирский и тувинский подвиды)

Castor fiber pohlei, C. f.tuvinicus

Индийский дикобраз

Летяга обыкновенная

Полевка Шидловского

Пеструшка желтая

Lagurus (Eolagurus) luteus

Песчанка Даля

Слепыш гигантский

Соня орешниковая

Сурок Мензбира

Сурок монгольский (тарбаган) (тувинская и читинская популяции)

Сурок прибайкальский черношапочный

Marmota camtschatica doppelmayeri

Малоазийский суслик

Spermophilus xanthoprymnus

Суслик крапчатый

Тушканчик карликовый бледный

Тушканчик карликовый Гептнера

Тушканчик карликовый жирнохвостый

Тушканчик карликовый пятипалый

Малый тушканчик

Тушканчик Северцова

Тушканчик-прыгун

Хомяк обыкновенный

Хомячок Роборовского

Цокор маньчжурский

Myospalax psilurus aspilanus

Отряд Непарнокопытные

Лошадь Пржевальского

Кулан туркменский

Отряд Парнокопытные

Горный баран, архар

Баран горный алтайский

Баран горный казахстанский

Баран горный каратауский

Баран горный кызылкумский

Баран горный тянь-шаньский

Баран горный устюртский

Баран снежный (путоранский и якутский подвиды)

Ovis nivicola borealis, O. n.lydekkeri

Горал амурский

Длинноиглый еж

Зубр европейский

Кабарга сахалинская

Moschus moschiferus sachalinensis

Козел безоаровый

Олень благородный тугайный

Cervus elaphus bactrianus

Олень дикий северный (новоземельская и алтае-саянская популяции)

Олень уссурийский пятнистый (аборигенная популяция)

Арменийский муфлон

Благородный олень

Благородный олень, Марал

Выдра кавказская

Выдра речная среднеазиатская

Среднеазиатская выдра

Кот барханный

Кот камышовый кавказский

Кошка лесная кавказская

Felis silvestris caucasica

Panthera pardusолень

Куница каменная

Куница лесная

Медведь белый

Медведь бурый

Медведь бурый тянь-шаньский

Норка европейская

Норка европейская кавказская

Песец голубой медновский

Полосатая гиена

Рысь европейская (обыкновенная)

Рысь центральноазиатская или туркестанская

Солонгой (дальневосточная популяция)

Тигр амурский

Хорь степной амурский

Mustela eversmanni amurensis

Отряд Ластоногие

Морж (атлантический и лаптевский подвиды)

Odobenus rosmarus rosmarus, O. r.laptevi

Нерпа кольчатая (балтийский и ладожский подвиды)

Phoca hispida botnica, P.h.ladogensis

Сивуч (морской лев северный)

Тюлень обыкновенный (европейский и курильский подвиды)

Phoca vitulina vitulina, P.v.stejnegeri

Тюлень серый (балтийский и атлантический подвиды)

Halichoerus grypus macrorhynchus, H.g.grypus

Отряд Китообразные

Дельфин белобокий атлантический

Дельфин беломордый

Lagenorhynchus albirostris

Афалина черноморская

Tursiops truncatus ponticus

Дельфин серый

Морская свинья (североатлантический, черноморский и северотихоокеанский подвиды)

Phocoena phocoen phocoena, P.p.relicta, P.p. vomerina

Косатка малая

Нарвал (едннорог)

Бутылконос высоколобый

Ремнезуб командорский

Кит гренландский

Eubalaena glacialis japonica

Кит синий северный

Balaenoptera musculus musculus

Финвал северный (кит сельдяной)

Balaenoptera physalus physalus

Сейвал (кит ивасевый)

Balaenoptera borealis borealis

Хингано-Архаринская низменность — Амурский филиал WWF

Название угодья:

Хингано-Архаринская низменность

Географические координаты:

49°10’ с.ш. 130°00’ в. д.

Географическое положение угодья:

Угодье расположено на крайнем юго-востоке Амурской области, у ее границ с Еврейской автономной областью и Китаем, в 110–200 км к ЮВ от центра области — г. Благовещенска. Угодье занимает Среднеамурскую равнину (долину Амура) от р.Буреи до р.Хинган, располагаясь юго-западнее Транссибирской железнодорожной магистрали.

Площадь угодья:

942000 га.

Высота:

87–127 м над уровнем моря.

Тип водно-болотного угодья:

По рамсарской классификации — Ts, Tp, O, M

По российской классификации — 2.5.1.1.

Критерии включения в список:

1a, 1c, 2a, 2b, 2c. Основные — 1c и 2a — уникальные ладшафты с гнездованием редких птиц.

Краткая характеристика угодья:

Уникальные ландшафты восточных влажных лесостепей (прерий) в долине Амура. Место массового гнездования редких птиц.

ФИЗИКО-ГЕОГРАФИЧЕСКАЯ ХАРАКТЕРИСТИКА

Рельеф

Среднеамурская равнина сложена неогеновыми и плейстоценовыми иловато-суглинистыми озерными отложениями. Низкая пойма Амура — это в основном острова и пляжи, на высокой пойме развит типичный комплекс с древними береговыми валами, старицами, ложбинами. Кроме того, имеется еще два уровня террас.

Гидрология

Реки имеют преимущественно дождевое питание, весенний паводок невелик, существеннее летние паводки после прохождения муссонных дождей.

Климат

Климат района — континентальный вариант умеренного муссонного климата восточного сектора континента с наиболее теплым на российском Дальнем Востоке летом. Средняя температура июля +20,5°С, января -25,5°С. Продолжительность безморозного периода — 100-110 дней, вегетационного – 140 — 160 дней. Выпадает 550 — 600 мм осадков в год, лишь примерно 15% — зимой. Снежный покров маломощен, поэтому почвы зимой промерзают на 1,5 — 2 м.

Почвы

Почвы преимущественно луговые, характеризуются высоким содержанием гумуса: 5-12%, с гумусовым горизонтом мощностью от 20 до 60 см («амурские черноземы»). В низинах развиты лугово-болотные, оглеенные почвы, под ними обычно имеется глинистый водоупорный слой.

Под лесами на хорошо дренированных участках высокой поймы развиты дерново-аллювиальные и буроземо-аллювиальные почвы.

ЭКОЛОГИЧЕСКИЕ УСЛОВИЯ

Основные пространства угодья заняты сырыми и заболоченными вейниковыми и разнотравно-осоково-вейниковыми лугами. Весной и после муссонных дождей на лугах подолгу стоит вода, поскольку они расположены на почвах с глинистым водоупорным слоем. Растительность очень густая и высокая — 100-120 см. До 80-85% зеленой массы приходится на вейник пурпурный. К нему примешиваются зюзник, дербенник, валериана и кровохлебка.

На лучше дренированных участках высокой поймы развиты разнотравно-осоково-вейниковые луга. Для них характерно высокое видовое разнообразие (60 видов) и обилие ярких и редких растений — лилии, башмачки, ирис мечевидный, пион молочноцветковый и т.п.

Небольшие площади на хорошо дренированных участках террас занимают суходольные луга из вейника наземного c красочным разнотравьем.

Бессточные понижения в местах с глинистым грунтом заболочены. Почвы здесь торфянисто-глеевые, с тяжелым

механическим составом. Высота травостоя — 40-50 см. Основной фон составляют осока пушистоплодная, и вейник незамечаемый с кочками из осоки Мейера. На более низких уровнях возрастает роль пушиц.

Устья рек, берега озер и стариц окружены тростниковыми болотами. Тростник достигает высоты 2 м. Кроме него, вдоль берегов растут образующие кочки виды осок, рогоз, стрелолист, аир, вахта, зюзники. В водоемах обычны рдесты, ряски, кувшинка малая, водяной орех.

ЦЕННАЯ ФАУНА

Роль района как места миграций птиц

В периоды сезонных миграций водоемы низменности привлекают десятки тысяч водоплавающих птиц, в т. ч. клоктуна, касатку, мандаринку и других уток, включенных в Красную книгу РФ. Из гусей наиболее обычны тундровый гуменник и белолобый гусь, также встречаются таежный гуменник, сухонос и серый гусь. Заметен пролет и кормовые кочевки даурского и черного журавлей, а также скопы и орлана-белохвоста. Фон миграции составляют такие виды как зимняк, канюк, полевой лунь, чирок-свистунок, кряква, большой крохаль, гольцовый конек, бурый и рыжий дрозды, несколько видов овсянок, пеночки, юрки и другие птицы.

Роль района как места гнездования

Гнездовая фауна птиц восточной лесостепи сложена как видами китайского комплекса (пегий лунь, большой погоныш, индийская кукушка, пестроголовая камышевка, ошейниковая овсянка), так и широко распространенными — дубровник, желтая трясогузка.

Роль района как места обитания редких и находящихся под угрозой исчезновения видов

Из гнездящихся птиц наибольшее значение низменность имеет для охраны популяций дальневосточного аиста, уссурийского (японского) и даурского журавлей, большого подорлика, дальневосточного кроншнепа, большого погоныша, дубровника. Кроме представителей южных орнитогеографических комплексов (например большой баклан, пегий лунь, хохлатый осоед, амурский кобчик, амурская выпь, мандаринка, индийская кукушка, иглоногая сова, уссурийская совка, седой дятел, большеклювая ворона, голубая сорока, сизый дрозд, пестоголовая камышевка, клинохвостый сорокопут и т.д.), хорошо представлены широкораспространенные виды птиц — тетеревятник, перепелятник, ушастая сова, сорока, пустельга, восточная черная ворона, черноголовый чекан и другие.

Роль района для сохранения биоразнообразия млекопитающих, амфибий, рептилий

Из млекопитающих интересны виды восточного комплекса — крысовидный хомячок, маньчжурский заяц и енотовидная собака в своем естественном ареале. С другой стороны, в фауне млекопитающих представлены степные элементы — даурский хомячок, длиннохвостый суслик.

ЦЕННАЯ ФЛОРА

Флора насчитывает более 800 видов сосудистых растений.

Из занесенных в Красную книгу России в районе отмечены следующие виды: бразения Шребера, диоскорея ниппонская, альдрованда пузырчатая, ирис мечевидный, Венерины башмачки настоящий и крупноцветковый, пионы молочноцветковый и обратнояйцевидный, водяной орех или чилим, лотос Комарова.

Смертельная болезнь младенцев и молодых сирийских хомяков, экспериментально инфицированных вирусом Имджин, новым хантавирусом, переносимым крокидурином землероек.

Infect Genet Evol. Авторская рукопись; доступно в PMC 1 декабря 2016 г.

Опубликован в окончательной редакции как:

PMCID: PMC4742371

NIHMSID: NIHMS724634

Se Hun Gu

a Отдел микробиологии, Медицинский колледж, Институт вирусных заболеваний , Корейский университет, 5-га, Анам-дон, Сонбук-гу, Сеул 136-705, Корея

b Тихоокеанский центр исследований новых инфекционных заболеваний, Джон А.Бернс, Гавайский университет в Маноа, 651 Ilalo Street, Гонолулу, HI 96813, США

Young-Sik Kim

c Отделение патологии, Больница Ансан, Медицинский колледж Корейского университета, Ансан 425-707 , Корея

Luck Ju Baek

a Кафедра микробиологии, Медицинский колледж, Институт вирусных заболеваний, Корейский университет, 5-ga, Anam-dong, Seongbuk-gu, Seoul 136-705, Korea

Takeshi Kurata

d Отделение патологии, Национальный институт инфекционных заболеваний, Тояма 1-23-1, Синдзюку, Токио 162-8640, Япония

Ричард Янагихара

b Тихоокеанский центр исследований новых инфекционных заболеваний, Джон А. Бернс, Гавайский университет в Маноа, 651 Ilalo Street, Гонолулу, HI 96813, USA

Jin-Won Song

a Отделение микробиологии, Медицинский колледж, Институт вирусных болезней Корейского университета, 5- ga, Anam-dong, Seongbuk-gu, Seoul 136-705, Korea

a Кафедра микробиологии, Медицинский колледж, Институт вирусных заболеваний, Корейский университет, 5-ga, Anam-dong, Seongbuk-gu, Seoul 136-705, Корея

b Тихоокеанский центр исследований новых инфекционных заболеваний, Джон А.Медицинская школа Бернса, Гавайский университет в Маноа, 651 Ilalo Street, Гонолулу, HI 96813, США

c Отделение патологии, Больница Ансан, Медицинский колледж, Корейский университет, Ансан 425-707, Корея

d Отделение патологии, Национальный институт инфекционных заболеваний, Тояма 1-23-1, Синдзюку, Токио 162-8640, Япония

* Автор-корреспондент: Отдел микробиологии Медицинского колледжа Института вирусных заболеваний Корейского университета, 5-Ga, Anam-dong, Seongbuk-gu, Сеул 136-705, Корея. Тел .: +82 2 920 6408; факс: +82 2 923 3645, [email protected] (J. -W. Song) Окончательная отредактированная версия этой статьи издателем доступна на Infect Genet Evol. См. другие статьи в PMC, в которых цитируется опубликованная статья.

Abstract

Чтобы получить представление о патогенности вируса Имджин (MJNV), нового хантавируса, выделенного из уссурийской белозубой бурозубки ( Crocidura lasiura ), групп сирийских хомяков ( Mesocricetus auratus (<) разного возраста) 1, 5, 10, 14, 21, 35 и 56 дни) инокулировали внутрибрюшинным путем 1000 БОЕ штаммов MJNV 04-55 и 05-11.Сирийские хомяки, инфицированные вирусом MJNV, в возрасте до 21 дня демонстрировали снижение активности, потерю веса, респираторный дистресс, паралич задних конечностей и судороги. Смерть наступила через 1-6 дней после начала клинического заболевания. РНК MJNV была обнаружена в головном мозге и других основных органах с помощью ОТ-ПЦР и ПЦР в реальном времени. Гистопатологическое исследование показало альвеолярное кровоизлияние, интерстициальную пневмонию и тяжелую легочную гиперемию; очаговый некроз печени и воспаление воротной вены; и острый менингоэнцефалит. Методом иммуногистохимии антиген MJNV был обнаружен в эндотелиальных клетках микрососудов легких и глиальных клетках.У хомячков старшего возраста (35 и 56 дней) развилась субклиническая инфекция без гистопатологических изменений. Необходимы дальнейшие исследования для определения патофизиологических основ разной возрастной восприимчивости сирийских хомяков к летальному заболеванию MJNV.

Ключевые слова: Вирус Имджина, сирийский хомяк, хантавирус, менингоэнцефалит

1. Введение

Грызуны (отряд Rodentia), принадлежащие к семействам Muridae и Cricetidae, давно известны как резервуарные хозяева хантавирусов (семейство ). Bunyaviridae, , род Hantavirus ), которые представляют собой оболочечные вирусы с отрицательным смысловым, одноцепочечным, трехчастным геномом РНК, состоящим из большого (L), среднего (M) и малого (S) сегментов, которые кодируют РНК- зависимая РНК-полимераза (RdRp), два гликопротеина оболочки (Gn, Gc) и нуклеокапсидный белок (NP), соответственно (Schmaljohn and Dalrymple, 1983; Schmaljohn et al. , 1983). Хантавирусы, такие как вирус Хантаан (HTNV), вирус Сеула (SEOV) и вирус Пуумала (PUUV), которые носят грызуны мюридов и арвиколид, вызывают геморрагическую лихорадку с почечным синдромом (HFRS), острое лихорадочное заболевание, характеризующееся различной степенью выраженности кровоизлияние и почечная недостаточность (Brummer-Korvenkontio et al., 1980; Lee et al., 1978; Lee and Vandergroen, 1989; Yanagihara and Gajdusek, 1988). Напротив, хантавирусы, такие как вирус Sin Nombre (SNV), вирус Анд (ANDV), вирус Black Creek Canal (BCCV) и вирус Choclo (CHOV), переносимые грызунами неотомина и сигмодонтина, вызывают хантавирусный легочный синдром (HPS), который характеризуется быстро прогрессирующей дыхательной недостаточностью с высокой смертностью (Duchin et al., 1994; Лопес и др., 1996; Нельсон и др., 2010; Никол и др., 1993; Равков и др., 1995; Заки и др., 1995).

В последнее время внимание было обращено на генетически отличные хантавирусы, обнаруженные с помощью полимеразной цепной реакции с обратной транскрипцией (ОТ-ПЦР) у многих видов землероек и кротов (отряд Eulipotyphla, семейства Soricidae и Talpidae) и насекомоядных летучих мышей (отряд Chiroptera) в широком диапазоне разделенные географические регионы по всей Европе, Азии, Африке и Северной Америке (Bennett et al. , 2014; Янагихара и др., 2014). Однако из более чем 30 хантавирусов, не переносимых грызунами, только два были выделены в культуре клеток. Первым из них является вирус Тоттапалаям (TPMV), первоначально выделенный из ткани селезенки азиатской бурозубки ( Suncus murinus ), пойманной в южной Индии в 1964 году (Carey et al., 1971; Song et al., 2007). И второй — вирус Имджин (MJNV), выделенный из тканей легких уссурийской белозубой землеройки ( Crocidura lasiura ), отловленный недалеко от демилитаризованной зоны в Корее (Song et al., 2009).

Неизвестно, инфицируют ли хантавирусы, передающиеся сорицидами, и вызывают ли они заболевания. В связи с этим малочисленность изолятов хантавирусов и отсутствие животных моделей для этих вновь обнаруженных хантавирусов, укрываемых землеройками, кротами и летучими мышами, препятствуют нашему пониманию их инфекционности и патогенности для людей. Мы пришли к выводу, что изучение клинических и патологических особенностей экспериментальной инфекции MJNV у лабораторных животных может косвенно дать представление о заболеваниях, вызванных MJNV, у людей. Более того, поскольку сирийский хомяк служил надежным хозяином для экспериментальной инфекции HFRS- и HPS-вызывающими хантавирусами, как для изучения патогенеза HPS, так и для тестирования хантавирусных вакцин (Brocato et al., 2014; Chu et al., 1995; Hooper et al., 1999, 2001, 2013; Safronetz et al., 2011, 2012; Sanada et al., 2011; Schmaljohn et al., 1990; Wahl-Jensen et al., 2007), мы выбрали этот cricetid грызунов для проведения экспериментального исследования инфекции MJNV. Наши результаты показывают, что у младенцев и молодых сирийских хомяков развивается смертельная болезнь, а у взрослых хомяков развивается субклиническая инфекция после внутрибрюшинной инокуляции MJNV.Такие модели могут дать ценную информацию о персистенции и патогенности MJNV и других хантавирусов, которые все еще остаются сиротами и не передаются грызунами, которые еще предстоит изолировать.

2. Материалы и методы

2.1. Вирус и культура клеток

Штаммы 04-55 и 05-11 MJNV, выделенные в клетках Vero E6 (Vero C1008; CRL 1586, Американская коллекция типовых культур, Манассас, Вирджиния) из тканей легких уссурийских белозубых землероек, пойманных в уезде Ёнчхон и город Паджу, соответственно, в Корее (Song et al. , 2009), размножались в клетках Vero E6, поддерживаемых в среде Игла, модифицированной Дульбекко с добавлением 5% инактивированной нагреванием фетальной бычьей сыворотки (Lonza, Walkersville, MD), 2 мМ L-глутамина и антибиотиков (пенициллин / стрептомицин) при 37 °. C при 5% CO 2 . По данным анализа бляшек (Song et al., 2009), титры инфекционности исходных материалов MJNV составляли 2 × 10 5 БОЕ / мл.

2.2. Заявление об этике

Все прививки и обращение с грызунами, а также методы эвтаназии и сбора тканей выполнялись в соответствии с установленными протоколами, одобренными Комитетом по уходу за животными и их использованию Корейского университета.

2.3. Животные и прививка вируса

Сирийских хомяков ( Mesocricetus auratus ), обозначенных как «свободные от особых патогенов», были приобретены у Daehan Biolink Co., Ltd (Чхунчхон-Пукто, Корея). Хомячки были разделены на семь групп (от 5 до 10 хомяков в группе) в соответствии с их постнатальным возрастом (<1, 5, 10, 14, 21, 35 и 56 дней), были инокулированы 1000 БОЕ штаммов MJNV 04-55 и 05-11 внутрибрюшинным путем. Ежедневно наблюдали за хомяками на предмет клинических признаков и умерщвляли в случае смерти или в установленные сроки после инокуляции.Эксперименты были прекращены через 42 дня после инокуляции. Для эвтаназии применялась анестезия изофлураном с последующей сердечной пункцией. Сыворотки тестировали на антитела иммуноглобулина G (IgG) против MJNV с помощью непрямого иммунофлуоресцентного теста на антитела (IFA) и иммуноферментного анализа (ELISA). Все эксперименты на животных проводились в условиях содержания ABSL-3, в учреждении, в котором никогда не работали с ANDV, SNV и другими хантавирусами, вызывающими HPS.

2.4. Экстракция РНК и ОТ-ПЦР

Общую РНК экстрагировали из 100 мг тканей (сердце, легкие, печень, почки, селезенка, кишечник и мозг) с использованием RNA-Bee (Tel-Test, Inc., Френдсвуд, Техас). Каждая реакционная смесь объемом 20 мкл содержала 10 мкл общей РНК, 2 мкл случайного праймера (10 мкМ), 1 мкл dNTP (Finnzymes, Vantaa, Финляндия), 0,5 мкл ингибитора РНКазы (Thermo Fisher Scientific. Waltham, MA), 0,5 мкл лейкемии мышей Молони. обратная транскриптаза вируса (M-MLV) (Promega, Madison, WI) и 4 мкл реакционного буфера M-MLV 5X. Реакцию проводили при 37 ° C в течение 1 часа и 94 ° C в течение 3 минут для конечной реакции. Реакции амплификации генов проводили в 50 мкл реакционных смесей, содержащих 200 мкМ dNTP 1.5 мМ MgCl 2 , 0,5 ед. Полимеразы Super-Therm Taq (JMR Holdings, Лондон, Великобритания) и 0,2 мкМ каждого праймера (Song et al., 2007). Последовательности олигонуклеотидных праймеров для полувложенной ПЦР представляли собой MJN-M2235F: 5′-CATGGAAGAGTGCAACATGT – 3 ′, MJN-M2855R: 5′ – TATGGTCCCTAGATGTACT – 3 ′, затем MJN-M2235FAT и MJN-M280 ′ – 3GATTC: MJN-M2805 ′ –3GATA: TCX-M2805. Первоначальная денатурация происходила при 94 ° C в течение 5 минут, затем следовали 15 циклов денатурации при 94 ° C в течение 40 секунд, отжиг при 50 ° C в течение 40 секунд, элонгация при 72 ° C в течение 1 минуты, затем 25 циклов денатурации при 94 ° C. ° C в течение 40 секунд, отжиг при 52 ° C в течение 40 секунд и удлинение при 72 ° C в течение 1 мин в Mastercycler ep gradient S (Eppendorf, Гамбург, Германия).

2,5. Конструирование стандартной РНК MJNV.

РНК

MJNV была сконструирована из вектора pSTBlue I (Novagen, Дармштадт, Германия) с клонированным фрагментом M сегмента длиной 570 п.н. Плазмиду линеаризовали рестрикционным ферментом EcoR I и служили в качестве матрицы для транскрипции РНК с использованием набора для транскрипции MEGAscript High Yield Transcription Kit (Ambion, Austin, TX) в соответствии с инструкциями производителя. Синтезированную РНК инкубировали с ДНКазой I (Roche Applied Science, Базель, Швейцария) при 37 ° C в течение 15 мин и очищали с использованием RNA-Bee (Tel-Test, Inc.). Концентрацию РНК измеряли с помощью спектрофотометра NanoDrop. После ОТ-ПЦР с использованием случайных праймеров (10 мкМ) 10-кратные серийные разведения кДНК использовали для создания стандартной кривой ПЦР в реальном времени.

2.6. Количественная ПЦР в реальном времени по Taqman

Праймеры и зонд, нацеленные на M-сегмент MJNV, были разработаны с использованием программного обеспечения Primer Express® версии 3. 0 (Applied Biosystems, Foster City, CA). Последовательности праймеров M-сегмента для ПЦР в реальном времени были MJN-RTM2439F: 5′-GTGAATGTAAGAAAATAACTGGAAATGACT – 3 ′ и MJN-RTM2515R: 5′ – GACTGTTGTGCTAAGTAGACATACCTTGA – 3 ′.Зонд (MJN-зонд 2471: 5′-CTCAGCACACATGGG-3 ‘) метили репортерным красителем FAM на 5′-конце и гасителем MGB / нефлуоресцентным на 3’-конце соответственно. Каждая реакционная смесь объемом 20 мкл содержала 1 мкл кДНК, 10 мкл мастер-смеси для экспрессии генов 2X TaqMan (Applied Biosystems), 0,5 мкл прямого и обратного праймеров (36 мкМ), 0,5 мкл флуоресцентного зонда (10 мкМ) и 7,5 мкл двойной деионизированной воды. Реакцию проводили при 50 ° C в течение 2 минут и 90 ° C в течение 10 минут с последующими 40 циклами при 95 ° C в течение 15 секунд и 60 ° C в течение 1 минуты в системе для ПЦР в реальном времени StepOne (Applied Biosystems). .

2.7. Тест IFA

Сыворотки инфицированных хомяков, разведенные 1:32, помещали в дубликаты лунок клеток Vero E6, инфицированных MJNV, наносили на 10-луночные предметные стекла, фиксировали холодным ацетоном в течение 10 минут и инкубировали при 37 ° C в течение 30 минут. мин. После инкубации предметные стекла промывали и добавляли 25 мкл меченного флуоресцеинизотиоцианатом (FITC) IgG против хомяка (Kirkegaard and Perry Laboratories, Гейтерсбург, Мэриленд) в каждую лунку и инкубировали при 37 ° C в течение 30 минут. После промывок предметные стекла исследовали на вирусспецифическую флуоресценцию с использованием флуоресцентного микроскопа Axioscope (Carl Zeiss AG, Оберкохен, Германия).Сыворотки, которые дали положительный результат при скрининговом тесте (что определяется по интенсивности внутрицитоплазматической гранулярной флуоресценции ++ или +++), титровали по конечной точке путем тестирования серийных двукратных разведений.

2,8. Гистопатология и иммуногистохимия

Ткани легких, печени, почек, селезенки, сердца и мозга фиксировали в 10% забуференном формальдегиде и заливали парафином. Тонкие срезы (4 мкм) каждой ткани, окрашенные гематоксилином и эозином (H&E), исследовали с помощью световой микроскопии. Для иммунолокализации NP MJNV в качестве первичного антитела использовали гипериммунную моноклональную асцитическую жидкость мыши, направленную против рекомбинантного нуклеокапсидного белка (rNP) MJNV 05-11, а в качестве вторичного антитела — козий антимышиный IgG (DAKO Cytomation, Carpinteria, CA). согласно инструкции производителя.Срезы тканей сначала депарафинизировали в ксилоле и абсолютном этаноле, затем обрабатывали раствором для извлечения мишени DAKO (DAKO Cytomation) при 90 ° C в течение 20 мин. Эндогенная пероксидазная активность была минимизирована обработкой срезов ткани 3% перекисью водорода. Хромоген и контрастный краситель представляли собой диаминобензидин и гематоксилин соответственно. Слайды были закреплены с водной монтажной средой для просмотра.

3. Результаты

3.1. Экспериментальная инфекция MJNV

У всех сирийских хомячков в возрасте от 1 до 21 дня (группы от I до V) развилось клиническое заболевание после внутрибрюшинной инокуляции 1000 БОЕ штаммов MJNV 04-55 и 05-11.Смертность этих детенышей и молодых хомяков колеблется от 62,5 до 100% (). Смерть обычно наступала через один-шесть дней после появления клинических признаков, которые включали потерю веса, снижение активности, тахипноэ, респираторный дистресс, паралич задних конечностей, судороги и летаргию. Выжившие хомяки имели серьезные неврологические последствия, когда их подвергали эвтаназии в конце 42-дневного периода наблюдения. Напротив, у хомяков в возрасте 35 лет (группа VI) и 56 дней (группа VII) развивалась субклиническая инфекция, при которой после инокуляции MJNV не было обнаружено признаков заболевания и смертности ().Неинокулированные контрольные хомячки также не проявляли признаков болезни.

Выживаемость сирийских хомяков, привитых в разном возрасте 1000 БОЕ штаммов MJNV 04-55 (A) и 05-11 (B). NC обозначает отрицательный контроль.

3.2. Ответ антител против MJNV

Антитела IgG против MJNV с титром от 512 до 4096 по тесту IFA были обнаружены в сыворотках хомяков в группах I-V с клиническим заболеванием (). Высокие титры антител IgG были обнаружены в момент смерти между 8 и 16 днями после инокуляции.Терминальные сыворотки выживших хомяков в группах I-V, собранные через 42 дня после инокуляции, имели аналогичные высокие титры антител против MJNV IgG. Несмотря на отсутствие клинических проявлений заболевания, хомячки в группе VI (возраст 35 дней) и группе VII (возраст 56 дней) показали антитела против MJNV по тесту IFA в конце 42-дневного периода наблюдения ().

Таблица 1

Сывороточные антитела IgG к MJNV с помощью IFA у хомяков, экспериментально инфицированных штаммами MJNV 04-55 и 05-11.

I 9019 дней 1 9019 9019 9019 9019 9019 9019 2 9019 II II дней) 9019 4,096 9019 9019 9019 9129 III (10 дней) 9019 9019 901 99 12 9 0193 9 0199 4096 9019 3 9019 9019 9019 9 0199 1,024
штамм MJNV 04-55 штамм MJNV 05-11
Возрастная группа No. Клинический результат дней после прививки IFA Titer Возрастная группа No. Клинический результат дней после прививки IFA Titer
SD 13 512 I (<1 дня) 1 SD 10 4,096
2 sd 10 4,096
3 sd 14 2,048 3 sd 9019 14 4096 4 sd 11 4,096
5 ss 42 4,096 5 SD 11 4,096
7 sd 11 4,096
9 SD 13 4,096
II (5 дней) 1 1 1 sd 10 4096
9019 4 2 sd 10 2,048 2 sd 10 2,048
3 sd 10 2,048
4 sd 10 1,024 4 sd 12
4096 5 нерж. 7 SD 12 512 90 194
8 sd 12 512
III (10 дней) 1 (10 дней) 1 SD 8 4,096
2 SD 9 1,024 2 2 3 sd 9 4,096 3 sd 10 4,096
4 9019 15 4,096
5 SD 9 4,096 5 901 94 SD 16 2,048
6 SD 10 4,096 6 11 4,096 7 нерж. (14 дней) 1 SD 9 4,096 IV (14 дней) 1 SD 10 4,096
4096 2 SD 10 4096
3 SD 4,096 3 sd 10 4,096
4 sd 12 4,096 4,096
5 SD 12 4,096 5 SD 11 4,096
SD 14 > 4,096
7 SD 13 4,096 7 SD SD 13 4,096 8 SD 15 > 4,096
9 нерж.
V (21 день) 1 sd 10 4,096 V (21 день) 1 sd 12 4,096
12 2,048 2 sd 12 4,096
3 sd 14 4,096
4 SS 42 4096 4 SD 15 4,096
5 н.ж. 42 4,096 5 sd 16 4,096 6 SS 42 1,024
VI (35 дней) 1 hs 42 4,096 VI (35199 дней) 42 2,048
2 hs 42 4,096 2 hs 42 4,096164 3 hs 42 4,096
4 hs 42 4 hs 42 4096
5 hs 42 4,096 6 hs 42 4,096 6 hs 42 4,096
7 42 4096
8 hs 42 4,096162 42 4,096162 4,096162 2,048 VII (56 дней) 1 час 42 256
2 hs 42 2,048 2 hs 42 2,048
3 hs 42 256
4 hs 42 512 4 hs 42 42 2,048 5 hs 42 512
6 hs 42 2,048 42 2,048 6 7 hs 42 1,024 7 hs 42
8 hs 42 1,024

3.3. Обычная ОТ-ПЦР

С помощью обычной ОТ-ПЦР РНК MJNV была обнаружена в сердце, легких, почках, селезенке и головном мозге всех или почти всех экспериментально инфицированных хомяков в каждой группе в возрасте до 14 дней (группы с I по IV. ) (). Штамм MJNV 04-55 был более гепатотропным, чем штамм MJNV 05-11. В группе V (возраст 21 день) умирающие и выжившие хомяки через 42 дня после инокуляции также имели широкое распространение РНК MJNV, особенно в легких и головном мозге. Точно так же у хомяков, привитых в возрасте 35 дней (группы VI), РНК MJNV отсутствовала во внутренних органах, но регулярно обнаруживалась в головном мозге.Интересно, что РНК MJNV даже была обнаружена в мозге двух хомяков, инокулированных штаммом MJNV 04-55 или 05-11 в возрасте 56 дней, несмотря на отсутствие клинических признаков заболевания, что позволяет предположить, что MJNV может быть нейротропным у хомяков.

Таблица 2

Вирусная РНК в тканях хомяков, инокулированных внутрибрюшинно штаммами MJNV 04-55 и 05-11, по данным традиционной ОТ-ПЦР.

день
Возрастная группа Ткани (№ вирусной РНК / № протестированной)
Сердце Легкое Печень Почка Селезенка Кишечник Мозг
MJNV 04-55 4/5 4/5 4/5 4/5 4/5 5/5
II (5 дней) 8/8 8/8 8/8 8/8 8/8 8/8 8/8
III (10 дней) 7/7 7/7 7/7 7 / 7 7/7 7/7 7/7
IV (14 дней) 8/8 8/8 8/8 8/8 8 / 8 5/8 8/8
V (21 день) 3/6 4/6 3/6 3/6 3/6 2/6 6 / 6
VI (35 дней) 2/7 0/7 0/7 0/7 0/7 0/7 6/7
VII (56 дней) 0/8 0/8 0/8 0/8 0/8 0/8 2/8
Отрицательный контроль * 0/5 0/5 0/5 0/5 0/5 0/5 0/5
MJNV 05-11
I (<1 день) 9/9 9/9 8/9 9/9 9/9 9/9 9/9
II (5 дней) 5 / 6 5/6 1/6 5/6 5/6 5/6 6/6
III (10 дней) 7/8 8/8 0/8 8/8 8/8 5/8 9019 4 8/8
IV (14 дней) 9/10 10/10 2/10 10/10 7/10 0/10 10/10
V (21 день) 6/6 5/6 0/6 6/6 3/6 1/6 6/6
VI (35 дней ) 0/8 0/8 0/8 0/8 0/8 0/8 7/8
VII (A56 дней) 0/7 1/7 0/7 0/7 0/7 0/7 2/7
Отрицательный контроль * 0/5 0/5 0/5 0/5 0/5 0/5 0/5

3.4. Количественная ПЦР в реальном времени

Как было определено количественной ПЦР в реальном времени, копии вирусной РНК в головном мозге хомячков, инфицированных MJNV, обычно превышали таковые в других органах (). Это особенно верно для хомяков в группах III, IV и V, привитых в возрасте 10, 14 и 21 дня, у которых количество копий РНК MJNV в головном мозге было в 50-1000 раз выше, чем в сердце, легких, печени, почках, селезенке и других животных. тонкий кишечник. У хомяков, инфицированных штаммом MJNV 04-55, вирусная РНК-нагрузка снижалась в зависимости от возраста в сердце, легких, селезенке и тонком кишечнике, но не в печени, почках и головном мозге (2).Менее четкая органоспецифическая картина была обнаружена у хомяков, инфицированных штаммом MJNV 05-11, но в целом также было очевидно возрастное снижение нагрузки РНК MJNV, за исключением мозга, который показал 10 4 до 10 5 Копий РНК MJNV / г (). Более того, сирийские хомяки, привитые в возрасте 35 и 56 дней, демонстрировали РНК MJNV в головном мозге через 42 дня после инокуляции, несмотря на отсутствие неврологических признаков (и).

Количественная оценка вирусной РНК с помощью ОТ-ПЦР в реальном времени в сердце, легких, печени, почках, селезенке и мозге сирийских хомяков, инокулированных штаммами MJNV 04-55 (A) и 05-11 (B).Количество копий РНК MJNV на грамм тканей отдельных хомяков показано для каждой возрастной группы. Терминальные ткани выживших хомяков собирали через 42 дня после инокуляции. Копии РНК MJNV в тонком кишечнике были аналогичны таковым в других тканях (данные не показаны).

3.5. Гистопатология

Исследование под световым микроскопом тканей, окрашенных гематоксилином и эозином, хомяков, умерших от экспериментальной инфекции штаммами MJNV 04-55 и 05-11, выявило широко распространенные аномалии в легких, печени и головном мозге (и).В частности, в тканях легких хомяков, инфицированных MJNV 04-55 () и MJNV 05-11 (), наблюдались альвеолярное кровоизлияние, сильная закупорка сосудов, утолщение интерстициальной ткани и тяжелая пневмония. В тканях печени наблюдалось воспаление воротного тракта и печени (), а также острое воспаление с некрозом гепатоцитов (). Тяжелое воспаление мозговых оболочек и моста () и острое воспаление паренхимы головного мозга с пролиферацией сосудов () также наблюдались у хомяков, инфицированных MJNV. Существенных патологических изменений в почках, селезенке и кишечнике не обнаружено (данные не показаны).

Гистопатология тканей легких, полученных от умирающих хомяков, инфицированных MJNV. (A) альвеолярное кровотечение у хомячка, инфицированного MJNV 04-55, группа I (возраст <24 часов), № 2; (B) интерстициальная пневмония у хомячка, инфицированного MJNV 04-55, группа I (возраст <24 ч), № 5; (C) тяжелый застой у хомячка, инфицированного MJNV 04-55, группа III (возраст 10 дней), № 4; (D) интерстициальная пневмония и застой у хомяка, инфицированного MJNV 04-55, группа IV (возраст 14 дней), № 8; (E) утолщение интерстициальной ткани у хомячка, инфицированного MJNV 04-55, группа VII (возраст 56 дней), No.6; (F) старое альвеолярное кровотечение и застой у хомячка, инфицированного MJNV 05-11, группа III (возраст 10 дней), № 2; (G) интерстициальная пневмония, тяжелое альвеолярное кровотечение и застой у хомячка, инфицированного MJNV 05-11, группа V (возраст 21 день), № 2; (H) легкое контрольного неинфицированного хомяка. Пятно H&E; Увеличение оригинальное, X200.

Гистопатология тканей печени и мозга, полученных от хомяков, инфицированных MJNV. (A) портальное воспаление в печени MJNV-инфицированного хомяка, группа I (возраст <24 ч), No.5; (B) портальное воспаление и перивенилит печени в печени хомячка, инфицированного MJNV 04-55, группа IV (возраст 14 дней), № 8; (В) острое воспаление с некрозами гепатоцитов в печени хомячка, инфицированного MJNV 05-11, группа IV (возраст 14 дней), № 10; (D) печень контрольного неинфицированного хомяка. (E) воспаление в головном мозге хомячка, инфицированного MJNV 04-55, группа I (<24 ч), № 5; (F) воспаление в головном мозге хомячка, инфицированного MJNV 04-55, группа III (возраст 10 дней), № 5; (G) острое воспаление в головном мозге хомячка, инфицированного MJNV 04-55, группа IV, №8; (H) мозг контрольного незараженного хомяка. Пятно H&E; Увеличение оригинальное, X200.

3.6. Иммуногистохимия

Путем иммуноокрашивания антиген NP MJNV был обнаружен в альвеолах и интерстиции тканей легких хомяков, инфицированных MJNV 04-55 и MJNV 05-11 (). Вирусные антигены также были обнаружены в цитоплазме глиальных клеток в ткани мозга хомяков, инфицированных MJNV 04-55 (). Интересно, что вирусные антигены были широко распространены в нейронах коры, включая дендриты без инфильтрации воспалительных клеток, в некоторых областях мозговых оболочек, а также в клетках Пуркинье и зернистых слоях мозжечка.Антиген NP MJNV не был обнаружен в других тканях (данные не показаны).

Иммуногистохимическая локализация NP MJNV в легочной и мозговой ткани хомяков, инокулированных MJNV. (A) Группа IV инфицированного MJNV 04-55 (возраст 14 дней), № 8. (B) Группа V инфицированного MJNV 05-11 хомяка (возраст 21 день), № 2. (C) легкое контрольного неинфицированного хомяка . (D) MJNV 04-55 группа IV инфицированного хомяка (возраст 14 дней), № 8. (E) мозг контрольного неинфицированного хомяка. Увеличение оригинальное, X400.

4.Обсуждение

Разработка животных моделей хантавирусной инфекции жизненно важна для лучшего понимания персистенции хантавируса. В таких моделях использовались естественные виды-резервуары-хозяева, такие как пойманные в дикой природе полосатые мыши ( Apodemus agrarius ) для HTNV (Lee et al., 1981), рыжие полевки ( Myodes glareolus ) для PUUV (Yanagihara et al., 1985a) и оленеводческих мышей ( Peromyscus maniculatus ) для SNV (Botten et al., 2000, 2003).Для изучения персистенции хантавируса также использовались более доступные мелкие лабораторные грызуны, такие как коричневые крысы ( Rattus norvegicus ) на инфекцию SEOV (Easterbrook et al., 2007), сирийские хомяки и монгольские песчанки ( Meriones unguiculatus ). для инфекции PUUV (Sanada et al., 2011; Yanagihara et al., 1985b).

Модели на животных для хантавирусной инфекции и болезней также облегчат тестирование вакцин-кандидатов и новых методов лечения. Попытки разработать модели HFRS и HPS у нечеловеческих приматов дали неоднозначные результаты (Groen et al., 1995; Клингстрем и др., 2002; МакЭлрой и др., 2002; Сиронен и др., 2008; Янагихара и др., 1988). Например, после интратрахеальной инокуляции PUUV у яванских макак ( Macaca fascicularis ) наблюдалась легкая протеинурия и / или микрогематурия (Groen et al., 1995; Klingström et al., 2002). Обнаружение PUUV РНК с помощью in situ гибридизации и локализация PUUV NP с помощью иммуногистохимии в тканях почек, селезенки и печени, а также повышенные уровни цитокинов согласуются с наблюдаемыми у пациентов с HFRS (Klingström et al., 2002; Sironen et al., 2008). В то же время легкая временная протеинурия и азотемия были вызваны у яванских макак и шимпанзе ( Pan troglodytes ) после внутривенной инокуляции вирусом Проспект-Хилл, предполагаемым непатогенным хантавирусом, укрываемым луговыми полевками (Yanagihara et al., 1988). Напротив, у макак cynomolgus, инокулированных внутривенным или аэрозольным путем высоколетальным HPS-вызывающим ANDV, не развилось клиническое заболевание (McElroy et al., 2002).

Попытки воспроизвести HFRS у грызунов в основном не увенчались успехом.Как правило, экспериментальная хантавирусная инфекция у грызунов либо протекает бессимптомно (Wahl-Jensen et al., 2007; Yanagihara et al., 1985b), либо характеризуется различной возрастной восприимчивостью и летальным менингоэнцефалитом (Kim and McKee, 1985; Kurata et al., 1983; McKee et al., 1985; Nakamura et al., 1985; Wichmann et al., 2002; Yamanouchi et al., 1984; Yoshimatsu et al., 1997). Недавно этому штамму мышей приписали возрастную предрасположенность мышей к летальному хантавирусному менингоэнцефалиту.То есть, хотя взрослые мыши обычно устойчивы, у нескольких штаммов взрослых особей Mus musculus (C57BL / 6, BALB / c, AKR / J и SJL / J) развивается фатальное нейроинвазивное заболевание после внутрибрюшинной инокуляции HTNV (Wichmann et al. , 2002). Хотя экспериментальный менингоэнцефалит у мышей не является подходящей моделью заболевания HFRS, он, тем не менее, служил приемлемой моделью инфекции, в которой можно было проверить эффективность противовирусного препарата, рибавирина (Huggins et al., 1986). Кроме того, модель инфекции PUUV на рыжих полевках использовалась для тестирования химерной вакцины core-PUUV NP от HBV (Ulrich et al., 1998), а защита от инфекции SEOV была достигнута у сирийских хомяков с помощью конструкции ДНК-вакцины, содержащей сегмент SEOV M (Hooper et al., 1999).

Главным прорывом в хантавирологии стала разработка модели летального HPS у сирийских хомяков, инокулированных ANDV (Hooper et al., 2001). Экспериментальная инфекция ANDV у взрослых сирийских хомяков характеризуется острой дыхательной недостаточностью и гистопатологическими данными в легких, которые практически неотличимы от таковых при HPS у людей (Hooper et al., 2001; Safronetz et al., 2011). Однако не все хантавирусы, вызывающие HPS, одинаково вызывают у сирийских хомячков HPS-подобные заболевания. Например, SNV и CHOV, два хантавируса, которые, как известно, вызывают HPS в Северной и Южной Америке, вызывают субклиническую инфекцию у хомяков (Eyzaguirre et al., 2008; Wahl-Jensen et al., 2007). Недавно временная иммуносупрессия дексаметазоном и моногидратом циклофосфамида сделала хомяков восприимчивыми к HPS с SNV (Brocato et al., 2014).

В этом предварительном исследовании мы попытались установить патогенный потенциал недавно изолированного хантавируса, переносимого землеройками, путем инокуляции сирийских хомяков разного возраста.Несмотря на различия в дизайне экспериментов от предыдущих исследований, включая возраст, путь инокуляции и дозу инокулята, сирийские хомячки, инфицированные MJNV, имели общие клинические и патологические особенности, о которых сообщалось у хомяков, экспериментально инфицированных ANDV и SNV (Brocato et al., 2014; Hooper et al. , 2001). Сходства включали респираторный дистресс, клиническое течение, наличие вирус-специфического IgG в начале клинического заболевания, широко распространенное воспаление в легких и печени, распределение хантавирусного антигена в эндотелиальных клетках микрососудов и общую высокую смертность.Однако явные различия также были очевидны. У инфицированных MJNV младенцев и молодых хомячков развилось неврологическое заболевание, характеризующееся параличом и судорогами, тогда как эти признаки отсутствуют у взрослых хомяков, инфицированных ANDV и SNV. Кроме того, MJNV вызывал некроз печени, а ANDV и SNV — нет. Кроме того, в отличие от экспериментальной инфекции ANDV и SNV у хомяков, отек легких не был очевиден у хомяков, инфицированных MJNV. Это напоминает то, что было зарегистрировано для CHOV, хантавируса, вызывающего HPS.То есть, несмотря на широкое распространение вирусного антигена в эндотелиальных клетках микрососудов легких, HPS-подобное заболевание и отек легких не наблюдались у сирийских хомяков, инфицированных CHOV (Eyzaguirre et al., 2008).

Важно отметить, что экспериментальная инфекция MJNV у младенцев и молодых хомяков показала возрастную предрасположенность к летальному исходу, в отличие от менингоэнцефалита, описанного ранее у мышей и крыс, экспериментально инфицированных HTNV (Kurata et al., 1983; McKee et al., 1985; Накамура и др., 1985; Яманучи и др., 1984). То есть MJNV вызывал заболевание только у хомяков в возрасте трех недель и младше, но не у хомяков, привитых в возрасте 35 и 56 дней. С другой стороны, ANDV и SNV вызывают у взрослых хомяков смертельную болезнь, подобную HPS.

Разработка моделей болезней человека на животных или использование животных для прогнозирования болезней человека чревато неопределенностью в отношении актуальности. Например, вирус Maporal, вызывающий HPS-подобную болезнь у хомяков (Milazzo et al., 2002), не связан с HPS у людей, и наоборот, CHOV, который вызывает HPS у людей (Nelson et al., 2010), не вызывает HPS у хомяков (Eyzaguirre et al., 2008). Таким образом, несмотря на патологию, связанную с MJNV, у хомяков, это не доказывает, что MJNV является патогенным для человека. Тем не менее, результаты, представленные здесь, позволяют предположить, что хомяки представляют собой модель острого заболевания, вызванного MJNV, и могут быть удобным экспериментальным хозяином для установления инфекционности и патогенности вновь обнаруженных хантавирусов, не переносимых грызунами, а также дают полезные подсказки о типе (ах). болезни, которую MJNV может вызвать у людей.То есть, в то время как неврологические проявления лишь изредка были признаком хантавирусной инфекции, переносимой грызунами, у людей (Cerar et al., 2007; Chan et al., 1996), нейротропизм и невропатология с высокой вирусной нагрузкой в ​​мозге MJNV инфицированные хомяки, требуют целевых исследований на предмет выявления коррелятов болезней у людей.

Основные моменты

  • Вирус Имджин, хантавирус землероек, вызывает смертельную болезнь у младенцев и молодых сирийских хомяков

  • Летальная болезнь характеризуется высокой вирусной нагрузкой и гистопатологией в легких и головном мозге

  • Сирийские взрослые

  • хомяки устойчивы к болезни, связанной с вирусом Имджин

Благодарности

Эта работа была частично поддержана грантами Национального института аллергии и инфекционных заболеваний (R01AI075057) и Национального института общих медицинских наук (P20GM103516) Национального Институты здравоохранения и Глобальная система эпиднадзора за возникающими инфекциями и ответных мер (GEIS), U.С. Министерство обороны.

Сноски

Заявление издателя: Это PDF-файл неотредактированной рукописи, принятой к публикации. В качестве услуги для наших клиентов мы предоставляем эту раннюю версию рукописи. Рукопись будет подвергнута копирайтингу, верстке и проверке полученного доказательства, прежде чем она будет опубликована в окончательной форме для цитирования. Обратите внимание, что во время производственного процесса могут быть обнаружены ошибки, которые могут повлиять на содержание, и все юридические оговорки, относящиеся к журналу, имеют отношение.

Ссылки

  • Беннетт С.Н., Гу Ш., Канг Х.Дж., Араи С., Янагихара Р. Реконструкция эволюционного происхождения и филогеографии хантавирусов. Trends Microbiol. 2014; 22: 473–482. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Botten J, Mirowsky K, Kusewitt D, Bharadwaj M, Yee J, Ricci R, Feddersen RM, Hjelle B. Экспериментальная модель заражения хантавирусом Sin Nombre у оленьих мышей ( Peromyscus maniculatus ) Proc Natl Acad Sci US A. 2000; 97: 10578–10583.[Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Botten J, Mirowsky K, Kusewitt D, Ye CY, Gottlieb K, Prescott J, Hjelle B. Стойкая инфекция вирусом Sin Nombre у оленьих мышей ( Peromyscus maniculatus ) модель: сайты репликации и специфической для цепи экспрессии. J Virol. 2003. 77: 1540–1550. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Brocato RL, Hammerbeck CD, Bell TM, Wells JB, Queen LA, Hooper JW. Модель летального заболевания хантавирусного легочного синдрома у сирийских хомяков с ослабленным иммунитетом, инфицированных вирусом Син Номбре.J Virol. 2014; 88: 811–819. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Brummer-Korvenkontio M, Vaheri A, Hovi T., von Bonsdorff CH, Vuorimies J, Manni T., Penttinen K, Oker-Blom N, Lähdevirta J. Nephropathia epidemica: обнаружение антигена рыжих полевок и серологическая диагностика инфекции человека. J Infect Dis. 1980; 141: 131–134. [PubMed] [Google Scholar]
  • Кэри Д.Е., Рубен Р., Паникер К.Н., Шоп Р.Э., Майерс Р.М. Вирус Тоттапалаям: предполагаемый арбовирус, выделенный от землеройки в Индии.Индийский J Med Res. 1971; 59: 1758–1760. [PubMed] [Google Scholar]
  • Cerar D, Avsic-Zupanc T., Jereb M, Strle F. Тяжелое неврологическое проявление инфекции Dobrava hantavirus. J Med Virol. 2007; 79: 1841–1843. [PubMed] [Google Scholar]
  • Чан К.П., Чан Ю.С., Дорайсингем С. Тяжелый случай геморрагической лихорадки с почечным синдромом в Сингапуре. Юго-Восточная Азия J Trop Med Public Health. 1996. 27: 408–410. [PubMed] [Google Scholar]
  • Чу Ю.К., Дженнингс Г.Б., Шмальджон К.С. Вакцина с вектором вируса осповакцины защищает хомяков от заражения вирусами Хантаан и Сеул, но не вирусом Пуумала.J Virol. 1995; 69: 6417–6423. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Duchin JS, Koster FT, Peters CJ, Simpson GL, Tempest B, Zaki SR, Ksiazek TG, Rollin PE, Nichol S, Umland ET, Moolenaar RL, Reef SE, Нольте КБ, Галлахер М.М., Батлер Дж. К., Брейман Р.Ф. для группы изучения хантавирусов. Хантавирусный легочный синдром — клиническое описание 17 пациентов с недавно выявленным заболеванием. N Engl J Med. 1994; 330: 949–955. [PubMed] [Google Scholar]
  • Истербрук Дж. Д., Цинк М.С., Кляйн С.Л.Регуляторные Т-клетки увеличивают устойчивость вируса зоонозного патогена Сеула в его резервуаре-хозяине. Proc Natl Acad Sci U S. A. 2007; 104: 15502–15507. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Eyzaguirre EJ, Milazzo ML, Koster FT, Fulhorst CF. Инфекция вируса чокло у сирийского золотого хомячка. Am J Trop Med Hyg. 2008. 78: 669–674. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Groen J, Gerding M, Koeman JP, Roholl PJM, Vanamerongen G, Jordans HGM, Niesters HGM, Osterhaus ADME.Модель макаки на хантавирусную инфекцию. J Infect Dis. 1995; 172: 38–44. [PubMed] [Google Scholar]
  • Хупер Дж. У., Камруд К. И., Элг Ф., Кастер Д., Шмальджон К. С.. ДНК-вакцинация сегментом М хантавируса вызывает нейтрализующие антитела и защищает от заражения сеульским вирусом. Вирусология. 1999; 255: 269–278. [PubMed] [Google Scholar]
  • Хупер Дж. У., Ларсен Т., Кастер Д. М., Шмальджон К. С.. Модель летального заболевания хантавирусного легочного синдрома. Вирусология. 2001; 289: 6–14. [PubMed] [Google Scholar]
  • Хупер Дж. У., Джослейн М., Баллантайн Дж., Брокато Р.Новая вакцина ДНК вируса Sin Nombre и ее включение в кандидатную пан-хантавирусную вакцину против хантавирусного легочного синдрома (HPS) и вакцины от геморрагической лихорадки с почечным синдромом (HFRS). 2013; 31: 4314–4321. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Huggins JW, Kim GR, Brand OM, McKee KT. Терапия рибавирином при инфекции вируса Хантаан у грудных мышей. J Infect Dis. 1986; 153: 489–497. [PubMed] [Google Scholar]
  • Ким Г.Р., Макки К.Т., мл. Патогенез инфекции вирусом Хантаан у мышей-сосунков: клинические, вирусологические и серологические наблюдения.Am J Trop Med Hyg. 1985; 34: 388–395. [PubMed] [Google Scholar]
  • Клингстрём Дж., Плюснин А., Вахери А., Лундквист А. Хантавирусная инфекция Пуумала дикого типа индуцирует цитокины, С-реактивный белок, креатинин и оксид азота у яванских макак. J Virol. 2002. 76: 444–449. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Kurata T., Tsai TF, Bauer SP, McCormick JB. Иммунофлуоресцентные исследования диссеминированной инфекции вируса Хантаан у мышей-сосунков. Infect Immun. 1983; 41: 391–398. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Lee HW, French GR, Lee PW, Baek LJ, Tsuchiya K, Foulke RS.Наблюдения за естественным и лабораторным заражением грызунов этиологическим агентом корейской геморрагической лихорадки. Am J Trop Med Hyg. 1981; 30: 477–482. [PubMed] [Google Scholar]
  • Ли Х.В., Ли П.В., Джонсон К.М. Выделение этиологического агента корейской геморрагической лихорадки. J Infect Dis. 1978; 137: 298–308. [PubMed] [Google Scholar]
  • Ли Х.В., Вандергроен Г. Геморрагическая лихорадка с почечным синдромом. Prog Med Virol. 1989. 36: 62–102. [PubMed] [Google Scholar]
  • Лопес Н., Падула П., Росси К., Лазаро М.Э., Франце-Фернандес М.Т.Генетическая идентификация нового хантавируса, вызывающего тяжелый легочный синдром в Аргентине. Вирусология. 1996; 220: 223–226. [PubMed] [Google Scholar]
  • МакЭлрой А.К., Брей М., Рид Д.С., Шмальджон К.С. Андский вирус заражения макак cynomolgus. J Infect Dis. 2002; 186: 1706–1712. [PubMed] [Google Scholar]
  • McKee KT, Kim GR, Green DE, Peters CJ. Инфекция вируса Хантаан у грудных мышей — вирусологические и патологические корреляты. J Med Virol. 1985. 17: 107–117. [PubMed] [Google Scholar]
  • Milazzo ML, Eyzaguirre EJ, Molina CP, Fulhorst CF.Мапоральная вирусная инфекция у сирийского золотого хомячка: модель хантавирусного легочного синдрома. J Infect Dis. 2002; 186: 1390–1395. [PubMed] [Google Scholar]
  • Накамура Т., Янагихара Р., Гиббс С.Дж., мл., Эмикс Х.Л., Гайдусек, округ Колумбия. Различная восприимчивость и устойчивость иммунокомпетентных и иммунодефицитных мышей к фатальной инфекции вируса Хантаан. Arch Virol. 1985. 86: 109–120. [PubMed] [Google Scholar]
  • Nelson R, Canate R, Pascale JM, Dragoo JW, Armien B, Armien AG, Koster F. Подтверждение наличия вируса Choclo как причины сердечно-легочного синдрома хантавируса и высокой распространенности антител в сыворотке крови в Панаме.J Med Virol. 2010; 82: 1586–1593. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Никол С.Т., Спиропулу С.Ф., Морзунов С., Роллин П.Е., Ксиазек Т.Г., Фельдманн Х., Санчес А., Чайлдс Дж., Заки С., Петерс С.Дж. Генетическая идентификация хантавируса, связанного со вспышкой острого респираторного заболевания. Наука. 1993; 262: 914–917. [PubMed] [Google Scholar]
  • Равков Е.В., Роллин П.Е., Ксязек Т.Г., Петерс С.Дж., Никол С.Т. Генетический и серологический анализ вируса канала Блэк-Крик и его связи с заболеванием человека и инфекцией Sigmodon hispidus .Вирусология. 1995; 210: 482–489. [PubMed] [Google Scholar]
  • Safronetz D, Zivcec M, Lacasse R, Feldmann F, Rosenke R, Long D, Haddock E, Brining D, Gardner D, Feldmann H, Ebihara H. Патогенез и реакция хозяина у сирийских хомяков после интраназальное инфицирование вирусом Анд. PLoS Pathog. 2011; 7: e1002426. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Safronetz D, Ebihara H, Feldmann H, Hooper JW. Модель хантавирусного легочного синдрома сирийского хомяка. Antiviral Res. 2012; 95: 282–292.[Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Sanada T, Kariwa H, Nagata N, Tanikawa Y, Seto T., Yoshimatsu K, Arikawa J, Yoshii K, Takashima I. Puumala, вирусная инфекция у сирийских хомяков ( Mesocricetus auratus ), напоминающий хантавирусную инфекцию у естественных хозяев-грызунов. Virus Res. 2011; 160: 108–119. [PubMed] [Google Scholar]
  • Schmaljohn CS, Dalrymple JM. Анализ РНК вируса Хантаан: свидетельство нового рода Bunyaviridae. Вирусология. 1983; 131: 482–491. [PubMed] [Google Scholar]
  • Schmaljohn CS, Hasty SE, Harrison SA, Dalrymple JM.Характеристика хантаанских вирионов — прототипа вируса геморрагической лихорадки с почечным синдромом. J Infect Dis. 1983; 148: 1005–1012. [PubMed] [Google Scholar]
  • Schmaljohn CS, Chu YK, Schmaljohn AL, Dalrymple JM. Антигенные субъединицы вируса Хантаан, экспрессируемые рекомбинантами бакуловируса и вируса осповакцины. J Virol. 1990; 64: 3162–3170. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Сиронен Т., Клингстрем Дж., Вахери А., Андерссон Л.С., Лундквист А., Плюснин А. Патология хантавирусной инфекции Пуумала у макак.PLoS One. 2008; 3: e3035. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Сонг Дж. У., Бэк Л. Дж., Шмальджон К. С., Янагихара Р. Вирус Тоттапалаям, прототип хантавируса, переносимого бурозубками. Emerg Infect Dis. 2007; 13: 980–985. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Song JW, Kang HJ, Gu SH, Moon SS, Bennett SN, Song KJ, Baek LJ, Kim HC, O’Guinn ML, Chong ST, Klein TA, Yanagihara R. Характеристика вируса Имджин, недавно выделенного хантавируса из уссурийской белозубой бурозубки ( Crocidura lasiura ) J Virol.2009; 83: 6184–6191. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Ulrich R, Lundkvist A, Meisel H, Koletzki D, Sjolander KB, Gelderblom HR, Borisova G, Schnitzler P, Darai G, Krüger DH. Химерные частицы ядра HBV, несущие определенный сегмент нуклеокапсидного белка хантавируса Пуумала, вызывают защитный иммунитет в модели на животных. Вакцина. 1998. 16: 272–280. [PubMed] [Google Scholar]
  • Валь-Йенсен В., Чепмен Дж., Ашер Л., Фишер Р., Циммерман М., Ларсен Т., Хупер Дж. У. Временной анализ инфекций сирийских хомяков вирусом Анд и вирусом Син-Номбре.J Virol. 2007. 81: 7449–7462. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Wichmann D, Grone HJ, Frese M, Pavlovic J, Anheier B, Haller O, Klenk HD, Feldmann H. Инфекция вируса Хантаана вызывает острое неврологическое заболевание, которое является смертельным для взрослые лабораторные мыши. J Virol. 2002; 76: 8890–8899. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Yamanouchi T, Domae K, Tanishita O, Takahashi Y, Yamanishi K, Takahashi M, Kurata T. Экспериментальное инфицирование новорожденных мышей и крыс геморрагической лихорадкой с почечным синдромом (HFRS ) вирус.Microbiol Immunol. 1984; 28: 1345–1353. [PubMed] [Google Scholar]
  • Янагихара Р., Эмикс Х.Л., Гайдусек, округ Колумбия. Экспериментальное заражение рыжих полевок вирусом Пуумала, этиологическим агентом эпидемической нефропатии ( Clethrionomys glareolus ) J Virol. 1985a; 55: 34–38. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Янагихара Р., Амикс Х.Л., Ли П.В., Ашер Д.М., Гиббс С.Дж., мл., Гайдусек, округ Колумбия. Экспериментальная хантавирусная инфекция у нечеловеческих приматов. Arch Virol. 1988. 101: 125–130. [PubMed] [Google Scholar]
  • Янагихара Р., Гу Ш., Араи С., Кан Х. Дж., Сон Дж. У.Хантавирусы: новое открытие и новые начинания. Virus Res. 2014; 187: 6–14. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Янагихара Р., Гайдусек, округ Колумбия. Геморрагическая лихорадка с почечным синдромом: историческая перспектива и обзор последних достижений. В: Gear JHS, редактор. Справочник CRC по вирусным и риккетсиозным геморрагическим лихорадкам. CRC press, Inc; Бока-Ратон, Флорида: 1988. С. 151–188. [Google Scholar]
  • Янагихара Р., Гольдгабер Д., Гайдусек, округ Колумбия. Распространение вируса эпидемической нефропатии у монгольских песчанок.J Virol. 1985b; 53: 973–975. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Йошимацу К., Арикава Дж., Охбора С., Итакура С. Инфекция хантавирусом у мышей SCID. J Vet Med Sci. 1997. 59: 863–868. [PubMed] [Google Scholar]
  • Zaki SR, Greer PW, Coffield LM, Goldsmith CS, Nolte KB, Foucar K, Feddersen RM, Zumwalt RE, Miller GL, Khan AS, Rollin PE, Ksiazek TG, Nichol ST, Mahy BWJ , Питерс CJ. Хантавирусный легочный синдром — Патогенез развивающегося инфекционного заболевания. Am J Pathol. 1995. 146: 552–579.[Бесплатная статья PMC] [PubMed] [Google Scholar]

Восточная Азия: Восточный Китай в Россию | Экорегион

Этот экорегион характеризуется безлесными или лесными ландшафтами в районе озера Ханка до самой верхней части реки Уссури на севере и вдоль долины реки Раздольная (Суипхун) на юге. В русской научной литературе она известна как Суйфун-Ханкайская впадина. Причины отсутствия лесов до сих пор являются предметом обсуждения среди биогеографов.Хотя климатические условия благоприятствуют развитию лесов, разрушительные пожары происходят регулярно с момента появления первых цивилизаций более 10 веков назад. Бохайская и чургенская цивилизации могли стать причиной образования огнестойких лугов и лесных сообществ из монгольского дуба. Долина, вероятно, была одновременно убежищем и биогеографическим «мостом» для многих видов во время оледенения позднего плейстоцена. Этим объясняется очень высокий уровень видового разнообразия и наличие растительных реликтов.К редким и исчезающим животным относятся амурский тигр, дальневосточный леопард. Многие виды рыб являются эндемиками озера Ханка или Уссури, а озеро Ханка является одним из самых важных мест для перелетных птиц во всей Восточной Азии. Здесь обитают редкие во всем мире журавли и ибисы. В неуправляемом состоянии осталось только 20% земель. Озеро Ханка подвержено побочным эффектам сельскохозяйственной промышленности, таким как вредные соединения, входящие в удобрения, биологические отходы животноводства и т. Д.

Описание
Расположение и общее описание

Особенности биоразнообразия
Первичные исследования, проведенные на территории вновь организованного Ханкайского заповедника, оценивают разнообразие млекопитающих в 48 видов (4 внесены в «Красную книгу России»), 338 птиц (44 внесены в «Красную книгу России». »), 7 рептилий (дальневосточная кожаная черепаха внесена в« Красную книгу России »), 6 земноводных (уссурийский тритон внесен в« Красную книгу России »).Краткая информация о редких видах животных, кроме птиц, приведена в таблице 1. Оценка разнообразия насекомых не проводилась, однако известно, что 12 видов насекомых занесены в «Красную книгу России». Большинство из них имеет восточную границу распространения в экорегионе.

Таблица 1. Животные, редкие или эндемичные для экорегиона

Семейство Общее название Научное название Статус
Рыбы
Семейство карповых Карп Plagiognathops microlepis, эндемик Ханка и Уссури
Семейство карповых Черный амурский лещ Megalobrama terminalis, эндемичный для Ханка, Уссури и Амур
Семейство карповых Черное амурское Mylohanuska endemicodon
Семейство сомов Солдатовский сом Silurus soldatovi, эндемик Ханка, Уссури и Амур
Семейство окуней Китайский окунь Siniperca chua-tsi, эндемичный для Ханка, Уссури и Амур
Амфибии
Уссурийский тритон Onychodactylus
Ecchodactylus
Ecch. Мягкие черепахи Дальневосточная кожаная черепаха Trionyx sinensis, эндемичная для Ханки, Уссури и Амура
Настоящие ящерицы Корейская длиннохвостая ящерица Takydromus wolteri Эндемик Уссурийского экорегиона и восточного Китая
Травяные змеи Полосатый бегун Coluber spinalis Единственное место в России
Млекопитающие Японские крот Могера вогу ra Единственная локация в России
Землеройки Гигантская бурозубая землеройка Sorex mirabilis Редкие и исчезающие виды
Землеройки Neomys fodiens Редкие и исчезающие виды
Летучие мыши Длиннопалые летучие мыши Myotis capcinii macrodactylus Редкие и исчезающие виды
Летучие мыши Ratsikon 96 Виды Myovotis Длиннохвостая летучая мышь Myotis frater Редкий вид
Летучие мыши Кожаная ночница Pipistrellus savii Редкая на Дальнем Востоке
Летучие мыши Восточная ночница Pipistrellus abramus Единственное местонахождение в России
Летучие мыши Обыкновенная длиннокрылая летучая мышь Miniopterus schreibersi Единственная локация на Дальнем Востоке России
Хомяки Маньчжурские хомяки Myospalax psilurus epsilanus Редкий вид
Собаки Красный волк Cuon alpinus Вымирающий и очень редкий вид
Семейство норок Mustela altaica Вымирающий и редкий вид
Кошки Уссурийский тигр Panthera tigris altaica Вымирающий и редкий вид
Кошки Дальневосточный леопард и очень редкий вид Panthera
C ats Дальневосточный лесной кот Felis euptilura Редкий вид в России
Семейство кораблей Амурский горный корабль Nemoraedus caudatus Редкий вид

Птицы на этой территории хорошо изучены из-за большого значения озера Ханка в их сезонной миграции и размножении.Из около 400 видов, отмеченных на территории, 44 вида занесены в Красную книгу Азии, а более 80 рекомендованы к особой охране на территории Дальнего Востока России. В таблице 2 представлена ​​наиболее важная часть исчезающих видов птиц.

Таблица 2. Редкие виды птиц

Семейство Общее название Научное название Бледный Статус
Шелдрейк Черношейный шельдрейк Podiceps nigricollis Nest Редкий вид
Шелдрейк Большой шельдрейк Podiceps cristatus Гнездо Редкий вид
Баклан Большой баклан Phalacrocorax carb Nest Редкий на Дальнем Востоке Семейство Nigricollus
Herta Вымирающий вид
Семейство цапель Большая белая цапля Egretta alba Гнездо Редкий вид
Семейство цапель Средняя белая цапля Egretta intermedia Гнездо Редкий вид
Семейство Ibis Platalea leucorodia Nest Очень редкий исчезающий вид
Семейство Ibis Красноногий ибис Nipponia nippon Nest Очень редкий вымирающий вид
семейство Дальневосточный аист Ciconia boyciana Гнездо Редкий вид с узким ареалом
Семейство аистов Черный аист Ciconia nigra Гнездо Редкий вид
Семейство уток Серый гусь Anser anser Nest Редко на Дальнем Востоке России
Семейство уток Гнездо сухоклювого гуся Cygnopsis cygnoides Гнездо Редкие и исчезающие виды
Утиная семья Лебедь Cygnus olor Migr Редко на Дальнем Востоке
Утиное семейство Лебедь Cygnus cygnus Nest Редко на Дальнем Востоке
Утиное семейство Tadorna cristata? Возможно, вымерший, последний раз видели в 1966 г.
Утиное семейство Черная кряква Anas poecilorhyncha Гнездо Уменьшение численности
Утиное семейство Утка-мандаринка Aix galericulata Nest Редкий вид с уменьшающейся популяцией
Утиная семья Барская черная утка Aythya baeri Гнездо Редкий вид
Ястребиное семейство Cristnisate wasp Гнездо Редко с уменьшающейся популяцией
Семейство ястребиных Черный коршун Milvus migrans Гнездо Уменьшение численности
Семейство ястребов Пятнистый рингтейл Circus melanoleucos Гнездо Уменьшение популяции
Семейство ястребов Ситиновый рингтейл Circus aeruginosus spilonotus Гнездо Редко с уменьшающимся населением
Ястребиное семейство Rip-одиночные ястребы
Семейство ястребиных Ястребиный сарих Butastur indicus Гнездо Редкий вид с узким ареалом
Семейство Ястребиный Орленок Aquila clanga Гнездо Редко с уменьшающейся популяцией
Семейство ястребиных Беркут Aquila chrysaetos Гнездо Редкий вид
Семейство ястребиных Черный грифон Aegyptus monachum Зимовка Редкий вид
Семейство Сокол Falcon Falco rusticolus Зимовка Редкий вид
Семейство черных петухов Уссурийский черный петух Lyrurus tetrix ussuriensis Гнездо Уменьшение численности
Семейство фазанов Бородатая куропатка Perdix dauuricae suschkini Гнездо Редкие виды
Отряд журавлей Turnix tanki Grus Виды японских журавлей Редкие виды Японских журавлей
japonensis Гнездо Чрезвычайно редкий вид
Семейство журавлей Белый журавль Grus leucogeranus Гнездо Чрезвычайно редкий вид
Семейство журавлей Даурский журавль Grus vipio Гнездо Чрезвычайно редкий вид
Семейство журавлей Черный журавль Grus monacha Гнездо Редко в России
Отряд журавлей Белокрылый рельс Porzana exquisita Гнездо Очень редко вид
Семейство Дрофа Дрофа Otis tarda dybowskii Migr Редкий вид
Отряд скватаролов Himantopus himantopus Гнездо Очень редкий вид

Текущее состояние

Типы и степень серьезности угроз

Обоснование разграничения экорегиона
В России нанесенные на карту границы экорегиона соответствуют дальневосточным суббореальным влажным низменностям и болотам, окружающим озеро Ханка.Линии взяты из карты ландшафтов СССР Исаченко (1988). Этот участок соответствует самому восточному лесостепному полигону Амурско-Маньчжурской лесной провинции по лесной карте СССР Курнаева (1990 г.). Он включает в себя относительно равнинный, невысокий регион к югу от озера Ханка, поскольку в этом районе есть ряд видов, занесенных в Красную книгу, общих с озером Ханка на севере. В пределах Китая границы соответствуют болотным лесам и пастбищам к северу от озера Ханка (классы 69 и 70) из Карты растительности Китая CVMCC (1979).Эти луга отделены от амурских лугов и лесных лугов Ванда-Шанем (входит в экорегион Маньчжурских смешанных лесов).

Ссылки
Комитет по составлению карты растительности Китая. 1979. Карта растительности

.

Китай. Карта (1: 10 000 000). Science Press, Пекин, Китай.

Курнаев С. 1990. Лесное районирование СССР (1: 16 000 000) М .: Кафедра геодезии и картографии.

Подготовил: Павел Крестов
Рецензировал: В процессе

Уссури | Факты и информация

Уссури берет свое начало в…

Очень мало известно о развитии этого редкого вида из семейства кошачьих, хотя считается, что он происходит из Приамурья в России, где он, вероятно, встречал диких кошек, более известных как «амурские лесные кошки». теории окружают развитие породы, хотя есть немного конкретных доказательств, чтобы сказать так или иначе. Однако распространено мнение, что уссури — это гибрид этих амурских лесных кошек и домашних пород, часто посещавших речной район.С годами уссури все реже наблюдаются в родной России, и считается, что из-за инбридинга и отсутствия программы разведения уссури, вероятно, вымрут, если этого не произошло.

Для Уссури характерны …

Из-за своей редкости об Уссури известно очень мало с точки зрения его структуры или внешнего вида. Многие любители кошек описывают его черты, как бенгальские, у которых коренастое спортивное телосложение, длинные ноги и мягкая, плотно прилегающая шерсть с полосатым рисунком.Уссури, вероятно, имеют естественную близость к воде, так как эволюционировали в районе реки Амур, где, вероятно, научились плавать как для развлечения, так и для выживания. Кроме того, мало что известно об уссури, о физических характеристиках которых можно только догадываться. Общее описание небольшой азиатской дикой кошки, которая обладает мускулистой структурой тела, ушами рыси, полосатыми ногами, окольцованным хвостом и различными отметинами на шерсти в виде бронзовых колец, полос или слившихся пятен.

Уссурийский средний…

Личность гибридной кошки трудно определить, а поскольку уссурийская особь является особенно редкой, существует мало свидетельств ее поведения в домашних условиях. Если судить по Бенгалии, средний уссури, скорее всего, потребует постоянного внимания и общения со стороны своих владельцев, не желая проводить долгие периоды времени в одиночестве. Уссури также могут проявлять интеллект, энергию и привязанность и хорошо реагировать на детей и других домашних животных, когда их вводят постепенно.Как правило, большинство гибридов диких и домашних кошек будут весить до 15 фунтов, а средняя продолжительность жизни при соответствующем уходе составляет 12-15 лет.

Слабые стороны …

Из-за неуловимой природы уссурийцев трудно определить какие-либо генетические или специфические для породы жалобы на здоровье, хотя ничто не говорит о том, что это что-то, кроме здоровья и устойчивости.

Характеристика вируса Имджин, нового хантавируса, выделенного из уссурийской белозубой бурозубки (Crocidura lasiura)

Ссылки

1 мая 1990 г. · Обзоры инфекционных заболеваний · Р. Янагихара

1 марта 1989 г. · Журнал Общая вирусология · J ArikawaC S Schmaljohn

1 января 1989 г. · Архив вирусологии · HG ZellerR E Shope

1 марта 1985 г. · Наука · CS SchmaljohnH L Regnery

1 июля 1985 г. · Журнал вирусологии · R YanagiharaD C Gajdusek

1 декабря 1985 · Журнал клинической микробиологии · PW LeeR Yanagihara

1 октября 1988 г. · Эпидемиология и инфекции · GE GlassJ W LeDuc

1 октября 1985 г. · Журнал инфекционных болезней · PW LeeC J Gibbs

января 1, 1969 · Журнал исследований ультраструктуры · AR Spurr

1 марта 1969 г. · Журнал инфекционных заболеваний · АЗ Капикиан Р. М. Чанок

1 сентября 1981 г. · Американский журнал тропической медицины и гигиены · HW LeeI W Seong

5 мая , 1984 · Ланцет · R YanagiharaA Svedmyr

1 января 1983 г. · Архив вирусологии · И. Н. Гавриловская М. П. Чумаков

1 марта 1981 г. · Американский журнал тропической медицины и гигиены · HW LeeR S Foulke

1 октября 1981 г. · Cell · MJ BibbD A Clayton

11 ноября 1994 · Исследования нуклеиновых кислот · JD ThompsonT J Gibson

7 апреля 1994 · Медицинский журнал Новой Англии · JS DuchinE T Umland

5 ноября 1993 · Наука · ST NicholC J Peters

1 января 1994 г. · Вирусология · YK ChuJ M Dalrymple

1 января 1994 г. · Вирусология · SY XiaoC S Schmaljohn

1 ноября 1996 г. · Журнал общей вирусологии · A PlyusninA Vaheri

27 января 1999 г. · Биоинформатика · D Posada, KA Crandall

27 июля 1999 г. · Вакцина · HW Cho, CR Howard

4 сентября 1999 г. · Исследование вирусов · A HeiskeH Feldmann

9 февраля 2000 г. · Журнал вирусологии · MK BoruckiS C St Jeor

6 октября 2000 г. · Молекулярная биология и эволюция · А.Л. Хьюз, Р. Фридман

, 16 августа, 2001 · Американский журнал тропической медицины и гигиены · RJ DouglassJ N Mills

6 апреля 2002 г. · Биоинформатика · Хайко А. ШмидтАрндт фон Хезелер

5 июля 2002 г. · Журнал вирусологии · Джейсон БоттенБрайан Хьелле

2 сентября 2003 г. · Молекулярная биология и эволюция · Эндрю П. Джексон, Майкл А. Чарльстон

3 октября 2003 г. · The Lancet Infectious Diseases · Олли ВапалахтиАнтти Вахери

14 апреля 2005 г. · Журнал болезней дикой природы · Чарльз Х. КалишерБарри Дж. Бити

26 октября 2005 г. · Журнал болезней дикой природы · Эми Дж. Куензи Джеймс Н Миллс

24 декабря 2005 г. · Журнал медицинской вирусологии · Лак Джу Бэк Джин-Вон Сон

27 декабря 2005 г. · Современная молекулярная медицина · Светлана Ф. Хайбуллина Стефен С. Сент-Джор

22 декабря , 2006 · Клиническая и вакцинная иммунология: CVI · Мегуми Окумура Дзиро Арикава

3 февраля 2007 г. · Молекулярная филогенетика и эволюция · Сильвен Дубей Петер Фогель

8 июня 2007 г. · Новые инфекционные заболевания · Борис КлемпаДетлев H Крюгер

23 августа 2007 г. · Журнал вирусологии · Прагья Д. Ядав Стюарт Т. Никол

20 сентября 2007 г. · Труды Национальной академии наук Соединенных Штатов Америки · Джудит Д. Истербрук Сабра Л. Кляйн

20 октября 2007 г. · The Журнал общей вирусологии · Ки-Джун Сон Джин-Вон Сон

31 октября 2007 г. · Журнал вирусологии · Джин-Вон СонРичард Янагихара

25 января 2008 · Новые инфекционные заболевания · Джин-Вон СонРичард Янагихара

26 января 2008 · Новые инфекционные заболевания · Джин-Вон Сонг Ричард Янагихара

7 февраля 2008 г. · Новые инфекционные заболевания · Сатору АраиРичард Янагихара

23 февраля 2008 г. · Тропическая медицина и международное здравоохранение: TM & IH · Герардо Рубен Куэто-Ольга, 9 октября, 15000 г., Вирджиния, 9000 г. 2008 · Систематическая биология · Александрос Стаматакис · Жак Ружмонт

16 октября 2008 · Труды Национальной академии наук Соединенных Штатов Америки · Сатору АраиРичард Янагихара

2 декабря 2008 · PLoS Возбудители · Джудит Д. Истербрук, Сабра Л. Кляйн

28 апреля 2009 г. · Вирусология · Хэ Джи Канг Ричард Янагихара


Цитирования

26 июля 2012 г. · Архивы вирусологии · Матиас Шлегель Бернд Кёльнер

, апрель 2012 г. Гены · Mathias SchlegelRainer G Ulrich

13 марта 2014 г. · Таланта · S ManzoorJ O Caceres

30 апреля 2010 г. Джи Канг Ричард Янагихара

23 мая 2012 · Переносимые переносчиками и зоонозные заболевания · Терри А. Кляйн Джин-Вон Сон

10 января 2012 · Переносимые переносчиками и зоонозные заболевания · Матиас Шлегель Райнер Г Ульрих

18 ноября 2011 · Журнал вирусологии Сиань-Дан Линь-Чжэнь Чжан

12 октября 2012 г. · Журнал вирусологии · Cadhla FirthW Ян Липкин

3 июня 2011 г. · Журнал вирусологии · Хэ Джи Канг Ричард Янагихара

17 марта 2011 г. · BMC Public Health · Клара Дж. Остроумие tTrudy L Philip

17 марта 2011 г. · BMC Public Health · Марк М. Фукуда Деннис Шанкс

26 ноября 2009 г. · Журнал вирусологии · Хэ Джи Канг Ричард Янагихара

30 июля 2011 г. · Журнал вирусологии · Хэ Джи Канг Ричард Янагихара 9 февраля , 2011 · Журнал вирусологии · Се Хун ГуДжин-Вон Сон

28 января 2012 г. · Журнал вирусологии · Лаарни СумибчайРичард Янагихара

8 июня 2012 г. · Журнал ветеринарной медицины · Такахиро СанадаИкуо Такашима

8 июля 2009 г. · PloS One · Хэ Джи Канг Ричард Янагихара

23 июня 2010 г. · PloS One · Джозеф ПрескоттБрайан Хьелле

15 февраля 2013 г. · Возбудители PLoS · Вэнь-Пин Го Ён-Чжэнь Чжан

ноября 7, 2009 · Новые инфекционные болезни A Klein

15 июня 2013 г. · Новые инфекционные заболевания · Сатору АраиКадзунори Оиси

8 сентября 2011 г. · Американский журнал тропической медицины и гигиены · Хэ Джи Канг Ричард Янагихара

1 марта 2014 г. · Вирусы · Изабелла Дж. ch

21 февраля 2014 г. · Исследование вирусов · Шу-Цин ЦзоВу-Чун Цао

3 мая 2014 г. · Вирусы · Се Хун Гуричард Янагихара

3 мая 2014 г. · Вирусы · Рената Карвалью де Оливейра Эльба Регина Сампайо де Лемос

18 июня 2014 г. · Вирусная иммунология · О’кей Сара ШинДжин-Вон Сон

24 мая 2014 г. · Тенденции в микробиологии · Шеннон Н. Беннетт Ричард Янагихара

31 мая 2014 г. · Исследование вирусов · Сиань-Дан Линь-Вон-Чжан

18 февраля , 2016 · Журнал вирусологии · Xing-Yi GeYun-Zhi Zhang

7 февраля 2013 г. · Текущее мнение в области вирусологии · Шанталь Реускен, Пол Хейман

2 марта 2011 г. · Антивирусные исследования · RN CharrelX de Lamballerie

28 июля 2009 г. · Инфекция, генетика и эволюция: журнал молекулярной эпидемиологии и эволюционной генетики в инфекционных заболеваниях · Фернандо Торрес-Перес Джозеф А Кук

16 сентября 2015 г. · Инфекция, генетика и эволюция: журнал молекулярной эпидемиологии и эволюционной генетики инфекционных болезней GuJin- Вон Сонг

2 декабря 2011 г. · Зоонозы и общественное здравоохранение · RL BurkeK G Vest

3 мая 2012 г. · Журнал векторной экологии: журнал Общества векторной экологии · Ми Янг Лим Янг Ран Джу

5 июля 2012 г. · Обзоры в области медицинской вирусологии · Антти ВахериОлли Вапалахти

16 марта 2011 г. · Журнал общей вирусологии · Юньчжи Чжан Чжэнли Ши

15 января 2014 г. · Исследование вирусов · Ричард Янагихара Джин-Вон Сонг

1 октября 2013 г. · Вирусология · Ок Сара ShinJin-Won Song

11 февраля 2014 г. · Исследование вирусов · Yong-Zhen Zhang

31 июля 2013 г. · Исследование вирусов · Катарина РесманТатьяна Авшич Зупанц

23 апреля 2013 г. · Инфекция, генетика и эволюция: Журнал молекулярной эпидемиологии и Эволюционная генетика при инфекционных заболеваниях · Лукаш РадосаБорис Клемпа

5 сентября 2012 г. · Вирусология · Ок Сара ШинДжин-Вон Сонг

11 января 2012 г. · Вирусология · Сатору АраиДжин-Вон Сон

3 декабря 2014 г. · Инфекция, генетика и эволюция : Журнал молекулярного эп. идеология и эволюционная генетика в инфекционных заболеваниях · Се Хун Гуричард Янагихара

2 августа 2011 г. · Инфекция, генетика и эволюция: Журнал молекулярной эпидемиологии и эволюционной генетики инфекционных болезней · Вэнь-Пин ГоЮн-Чжэнь

сентября 2013 г. ·

сентября 2013 г. Инфекция, генетика и эволюция: журнал молекулярной эпидемиологии и эволюционной генетики инфекционных заболеваний · Се Хун Гу Ричард Янагихара

23 июля 2013 · Журнал клинической вирусологии: официальная публикация Панамериканского общества клинической вирусологии · Джи Юн НохДжин-Вон Песня


404 Файл не найден в сетевой карте


Осоит на ванхентунут

Funettiin liittyvät www-ohjesivut siirtyivät jo aikaa sitten http: // www.csc.fi/hallinto/funet/ osoitteen taakse ja vain WWW.FUNET.FI etusivun osoite on ohjattu uuteen paikkaan sivustorakenteen muututtua. Olkaa hyvä ja korjatkaa mahdollinen vanhentunut kirjanmerkkinne. Jos linkki oli HTML-sivulla niin ilmoittakaa sen ylläpitäjälle. Jos etsitte tietoa CSC — Tieteellinen tietotekniikan keskus Oy: stä menkää ystävällisesti osoitteeseen WWW.CSC.FI

Yrititte listata tiedostohakemistoa http: llä

Tarkistakaa saamanne осоит.Pitäisikö siinä kenties olla alussa ftp: // eikä http: //. FTP-arkistossa oleviin tiedostoihin ja sivuihin tulisi viitata ftp://FTP.FUNET.FI/ tai http://www.nic.funet.fi alkuisilla URL: llä. WWW.FUNET.FI vaihtoehto toimii Эделлин Коса се на ollut käytössä Webin alkuajoista asti.

Olkaa hyvä ja käyttäkää http://www.nic.funet.fi/ osoitetta tai perinteistä ja virallista FTP-palvelua FTP.FUNET.FI selailuun ja lataukseen. Ongelmatilanteissä käyttäkää erillista FTP-ohjelmaa, joka näyttää teille kaikki palvelimen ilmoitukset.

ftp ftp.funet.fi
пользователь: анонимный
пароль: [email protected]
 

Osoitteessa on kirjoitusvirhe

URL: ssä jokainen merkki isot ja pienet kirjaimet ovat merkitseviä. Tarkistakaa erityisesti kaikki erikoismerkit. Ääkkösiä ja muita kansallisia merkkejä на yleensä vältetty merkkijärjestelmien eroista johtuvien ongelmia takia ja ne on useimmiten korvattu englannin аккосилла.

Tiedostoa tai hakemistoa ei todellakaan ole

Käytitte virheellistä tai vanhentunutta URL: ää tiedostoon, jota meillä ei ole.Jos kyseessä on uusi meille peilattava tiedosto, se saattaa saapua mahdollisten levytilapuutteiden tai muiden ongelmien selvittyä. Jotkin peileistämme kattavat myös vain osan alkuperäisestä kokoelmasta levytilan säästämiseksi. Voitte yrittää vaikka etsiä puuttuvaa tiedostoa webin hakukoneilla.

Me olemme tehneet jonkin virheen

Koska arkistossa on monia pääosin vapaaehtoisia ja kiireisiä ylläpitäjiä ja miljoonia eri puolilta maailmaa saapuvia tiedostoja kyseessä voi toki olla myös meidän virheemme, jota epäillessänne ilmoittakaa ystävällisesti kyseisen alueen ylläpitäjille (pub alihakemiston nimi + -adm (esim linux-adm) в nic.funet.fi) ja laittakaa kirjeeseen URL: t, ajankohta ja muu mahdollisesti ongelman selvittelyssä auttava tieto.

Вы перешли по устаревшему URL на некоторую веб-страницу FUNET
Несколько лет назад общие информационные страницы FUNET были перемещен по адресу http://www.csc.fi/english/institutions/funet URL. Только главная страница была перенаправлена ​​с традиционной Адрес WWW.FUNET.FI, так как остальная часть структуры страницы полностью изменилась.Удалите старый URL-адрес, по которому вы могли попасть в к этому сообщению об ошибке. Для получения информации о нашей компании CSC — IT Center for Science Ltd перейдите непосредственно на WWW.CSC.FI

Вы пытались указать каталог на www.funet.fi, используя протокол http

Пожалуйста, проверьте, должно ли ftp: // быть в начале URL-адреса. of http: // Ссылки должны иметь форму ftp://ftp.funet.fi/ или http://ww.nic.funet.fi/. Веб-сайт WWW.FUNET.FI альтернатива все еще сохраняется, так как она использовалась с рассвет Интернета.

Используйте http://www.nic.funet.fi/ или старый добрый официальный анонимный Служба FTP на FTP.FUNET.FI для просмотра и загрузки. В случае проблем с FTP попробуйте использовать настоящий FTP-клиент в линейном режиме, который показывает все сообщения, которые FTP-сервер может вам сообщить.

ftp ftp.funet.fi
пользователь: анонимный
пароль: [email protected]
 

В URL-адресе допущена опечатка

Каждый символ, включая заглавные и строчные буквы, имеет смысл. в URL.Обратите особое внимание на специальные символы и возможные национальные символы, которые обычно переводятся на некоторые английские эквиваленты.

Файл или каталог действительно не существует

URL неверный или устарел. Если это новый файл, мы должны отразить его здесь он может появиться даже после того, как будет решена возможная нехватка дискового пространства или другие проблемы. Некоторые из наших зеркал содержат только часть исходного сайта, чтобы сэкономить место на диске.А пока попробуйте найти свой файл с помощью поисковых систем.

Мы допустили ошибку

Так как мы люди и в основном перегружены работой добровольцы, наблюдающие за миллионами файлов со всего мира, это вполне возможно. Заранее приносим свои извинения и стараемся исправьте проблему. Свяжитесь с соответствующей областью администраторы (имя подкаталога / pub + -adm (например, linux-adm) на сайте nic.funet.fi) и сообщают им URL-адрес, дату, время и другую информацию, которая может иметь отношение к решению проблемы.

Генетическая изменчивость периферической популяции большого длиннохвостого хомяка Tscherskia triton (De Winton 1899) в северо-восточной части ареала по данным секвенирования контрольной области митохондриальной ДНК

  • Борисов Ю. М. и Кораблев В.П. Гетерохроматин у большого длиннохвостого хомячка Tscherskia triton de Winton (Rodentia, Cricetidae). Сообщение 1, Цитол. Genet., 1978, т.12, вып. 2. С. 130–133.

    PubMed Google Scholar

  • Борисов Ю.М. Гетерохроматин у большого длиннохвостого хомячка Tscherskia triton de Winton (Rodentia, Cricetidae). Сообщение 2, Цитол. Genet., 1978, т. 12, вып. 2. С. 250–255.

    PubMed Google Scholar

  • Борисов Ю.М. Полиморфизм и распределение В-хромосом в зародышевой линии и соматических клетках Tscherskia triton de Winton (Rodentia, Cricetinae), Генетика.J. Genet. , 2012, т. 48, нет. 5. С. 538–542.

    CAS Статья Google Scholar

  • Кассель А. и Таммару Т. Изменчивость аллозимов в центральных, периферических и изолированных популяциях редкой вересковой пустоши (Coenonympha hero: Lepidoptera, Nymphalidae): значение для сохранения, Conserv. Genet., 2002, № 4. С. 83–93.

    Артикул Google Scholar

  • Каннелл, Р., Ценность сохранения периферийных популяций: вспомогательная наука, в Proc. Видовой риск 2004: Пути к выздоровлению. Конф. , Виктория: Британская Колумбия, 2004 г., стр. 1–17.

    Google Scholar

  • Corbet, G.B., Млекопитающие Палеарктического региона: систематический обзор , Нью-Йорк: Британский музей Корнельского университета. Пресс, 1978.

    Google Scholar

  • Донг, Дж., Ли, К., и Чжан, З., Зависимая от плотности генетическая изменчивость в динамических популяциях длиннохвостого хомяка ( Tscherskia triton ), J. Mamm., 2010, т. 91, нет. 1. С. 200–207.

    Артикул Google Scholar

  • Экерт, К.Г., Самис, К.Е., и Лугид, С.С., Генетическая изменчивость в географических ареалах видов: центральная маргинальная гипотеза и не только, Мол. Экол., 2008, вып. 17, стр.1170–1188.

    CAS Статья PubMed Google Scholar

  • Эллерман, Дж. Р. и Моррисон-Скотт, T.C.S., Контрольный список млекопитающих Палеарктики и Индии с 1758 по 1946 год , Лондон: Британский музей попечителей (естественная история), 1951.

    Google Scholar

  • Гарсия-Рамос, Г. и Киркпатрик, М., Генетические модели адаптации и потока генов в периферических популяциях, Evolution, 1997, no.51. С. 21–28.

    Артикул PubMed Google Scholar

  • Громов И.М., Отряд Rodentia, в Млекопитающие фауны СССР , М .: Изд. АН СССР, 1963. С. 244–638.

    Google Scholar

  • Hall, T.A., BioEdit: удобный редактор для выравнивания биологических последовательностей и программа анализа для Windows 95/98 / NT, Nucl. Acids Symp., 1999, т. 41. С. 95–98.

    CAS Google Scholar

  • Хьюитт Г.М., Некоторые генетические последствия ледниковых периодов и их роль в дивергенции и видообразовании, Biol. J. Linnaean Soc., 1996, нет. 58. С. 247–276.

    Артикул Google Scholar

  • Hou, P., Wei, M., Zhang, L.X., и Liu, N.F., Генетическая структура краевой популяции у каменной куропатки Пшеваски Alectoris magna , Acta Zool.Син., 2002, т. 48, нет. 3. С. 333–338.

    CAS Google Scholar

  • Хуанг З., Лю Н. и Чжоу Т. Сравнительное исследование генетического разнообразия периферических и центральных популяций чукарской куропатки из северо-западного Китая, Biochem. Genet., 2005, т. 43, нет. 11. С. 613–621.

    CAS Статья PubMed Google Scholar

  • Хуанг, З.Х., Лю Н.Ф., Чен Ю.К., Сяо Ю.А., Генетическое разнообразие периферических и центральных популяций куропаток с ржавым ожерельем ( Alectoris magna ) на основе митохондриальной и микросателлитной ДНК, Acta Zool. Акад. Sci. Hungar., 2009, т. 55, нет. 2. С. 187–197.

    Google Scholar

  • Джейн С.К., Рай К.Н. и Сингх Р.С. Популяционная биология Avena, 11: вариации в периферических изолятах A. barbata, Genetica, 1981, no.56. С. 233–215.

    Артикул Google Scholar

  • Джонс, Дж. К. и Джонсон, Д. Х., Краткий обзор зайцеобразных и грызунов Кореи, Univ. Kansas Publ. Mus. Nat. Hist., 1965, т. 16, нет. 3. С. 357–407.

    Google Scholar

  • Картавцева И.В. и Алексеева Е.В. Подвиды большого длиннохвостого хомяка Tscherskia triton De Winton, 1899 (Rodentia, Cricetidae) на Дальнем Востоке СССР и его ископаемые остатки из южного Приморья, в Вопросы эволюционной зоологии и генетики эволюционной зоологии и генетики млекопитающих. Владивосток: Биол.-Почв. Inst. ДВО АНСССР, 1987, с. 96–106.

    Google Scholar

  • Картавцева И.В., Борисов Ю.М., Ляпунова Е.А., Воронцов Н.Н., Кораблев В.П. Дополнительные хромосомы крысоподобного хомячка ( Tscherskia triton ) и его таксономический статус, Ж., 1980, т. 59, нет. 6. С. 899–904.

    Google Scholar

  • Кох, Х.С., Эгер, Дж., Oh, JG, Lim, B., Lee, BK, Jang, KH, In, ST, длиннохвостый хомяк, Tscherskia triton nestor (Rodent Lee, JH, Kim, KS, and Kweon, GH, Генетическая особенность большая ia: Mammalia) с острова Чеджу, Корея: анализ последовательности цитохромоксидазы I и цитохрома b, Animal Cells Syst., 2013, vol. 17, нет. 1. С. 31–35.

    CAS Статья Google Scholar

  • Костенко В.А., Грызуны (Rodentia) Дальнего Востока России (Грызуны (Rodentia) Дальнего Востока России), Владивосток: Дальнаука, 2000.

    Google Scholar

  • Ламми А., Сиикамами П. и Мустаярви К. Генетическое разнообразие, размер популяции и приспособленность центральных и периферических популяций редкого растения Lychnis viscara, Conserv. Биол., , 1999, вып. 13. С. 1069–1078.

    Артикул Google Scholar

  • Лесика П. и Аллендорф Ф.В., Когда периферийные популяции являются ценными для сохранения ?, Conserv.Биол., , 1995, вып. 9. С. 753–760.

    Артикул Google Scholar

  • Либрадо П. и Розас Дж., DnaSP v5: программа для комплексного анализа данных полиморфизма ДНК, Bioinformatics, 2009, no. 25. С. 1451–1452.

    CAS Статья PubMed Google Scholar

  • MacArthur, R.H. and Wilson, E.O., Theory of Island Biogeography , Princeton, New Jersey: Princeton Univ.Press, 1967.

    Google Scholar

  • Маниатис Т., Фрич Э. Ф. и Сэмбрук Дж., Молекулярное клонирование, Колд-Спринг-Харбор, , Нью-Йорк: Лаборатория Колд-Спринг-Харбор. Пресс, 1982.

    Google Scholar

  • Mayr, E., Animal Species and Evolution , Cambridge, MA: Harvard Univ. Пресс, 1963.

    Книга Google Scholar

  • Макохониенко, М., Китагава, Х., Нарус, Т., Насу, Х., Момохара, А., Окуно, М., Фуджики, Т., Лю, X., Ясуда, Ю., и Инь, Х., Поздний голоцен, природный и антропогенные изменения растительности в Dongbei Pingyuan (Маньчжурская равнина), Северо-Восточный Китай, Quatern. Инт., 2004, вып. 123. С. 71–88.

    Артикул Google Scholar

  • Ней М., Маруяма Т. и Чакраборти Р. Эффект узкого места и генетическая изменчивость в популяциях, Evolution, 1975, no.29, стр. 1–10.

    Артикул PubMed Google Scholar

  • Нойман, К., Мишо, Ж., Лебедев, В., Йигит, Н., Колак, Э., Иванова, Н., Полтораус, А., Суров, А., Марков, Г., Маак С., Нойманн С. и Гаттерманн Р. Молекулярная филогения подсемейства Cricetinae на основе митохондриальных генов цитохрома b и 12S рРНК и ядерного гена vWF, Mol. Филогенет. Evol., 2006, № 2, с. 39. С. 135–148.

    CAS Статья PubMed Google Scholar

  • Оводов Н.Д. Позднеантропоценовая фауна млекопитающих (Mammalia) юга Уссурийского края // Фауна и систематика позвоночных Сибири . Новосибирск: Наука, 1977. С. 157–177.

    Google Scholar

  • Петите Р.Дж., Мусадик А.Е. и Поас О. Определение популяций для сохранения на основе генетических маркеров, Conserv. Биол., 1998, вып. 12. С. 844–855.

    Артикул Google Scholar

  • Сонг, М., Чжан, З., Нойман, К., Гаттерманн, Р., Распространение большого длиннохвостого хомячка ( Tscherskia triton ) по признаку пола, обнаруженное микросателлитами, Can. J. Zool., 2005, т. 83, нет. 66. С. 773–779.

    CAS Статья Google Scholar

  • Тамура, К., Петерсон, Д., Петерсон, Н., Стечер, Г., Ней, М., и Кумар, С., MEGA5: анализ молекулярной эволюционной генетики с использованием максимального правдоподобия, эволюционного расстояния и максимума методы экономии, Мол.Биол. Эволюция, .2011. 28. С. 2731–2739.

    CAS Статья PubMed PubMed Central Google Scholar

  • Тигерстедт П.М.А., Исследования изоферментных вариаций в маргинальных и центральных популяциях Picea abies, Hereditas, 1973, no. 75. С. 47–60.

    CAS Статья PubMed Google Scholar

  • Воронцов Н.Н. Низшие хомякообразные (Cricetidae) мировой фауны (Lower Cricetidae (Cricetidae) мировой фауны), гл.1, в серии «Фауна СССР», вып. 125: Млекопитающие , т. 1, с. 3, вып. 6, Ленинград: Наука, 1982.

    Google Scholar

  • Воронцов Н.Н. и Раджабли С.И. Хромосомная и видовая автономия Tscherskia albipes (Rodentia, Cricetidae), в Млекопитающие (эволюция, кариология, систематика, фаунистика) (Млекопитающие (эволюция, кариология, систематика), Новосибирск, 1969), Фаунистика. , стр.96–97.

    Google Scholar

  • Ван Ю.К., Чжан З.Б. и Сюй Л.Х., Генетическое разнообразие центральных и периферических популяций крысоподобных хомяков (Cricetulus triton), Chin. Sci. Бюл., 2001, вып. 46. ​​С. 1644–1650.

    Google Scholar

  • Wilson, D.E. и Ридер, Д.М., Виды млекопитающих мира: таксономический и географический справочник , Балтимор: John Hopkins Univ.Пресс, 2005, т. 2.

  • Вон, К., Смит, К.Г., История и современное состояние млекопитающих Корейского полуострова, Млекопитающие. Rev., 1999, т. 29, нет. 1. С. 3–33.

    Артикул Google Scholar

  • Се Дж. И Чжан З., Филогеография митохондриальной ДНК популяций Cricetulus triton на равнине северного Китая, J. Mamm., 2005, т. 86, нет. 4. С. 833–840.

    Артикул Google Scholar

  • Се, Дж.и Zhang, Z., Генетическое разнообразие уменьшается с уменьшением плотности популяции: последствия временных вариаций частот митохондриальных гаплотипов в естественной популяции Tscherskia triton , Integrat. Зоол., 2006, вып. 1. С. 188–193.

    Артикул Google Scholar

  • Xu, L., Xue, H., Song, M., Zhao, Q., Dong, J., Liu, J., Guo, Y., Xu, T., Cao, X., Wang , Ф., Ван, С., Хао, С., Ян, Х., и Чжан, З., Изменение генетического разнообразия в быстро растущей популяции длиннохвостого хомяка ( Tscherskia triton ), выявленное микросателлитами, PLoS One, 2013, т. 8, стр. e54171. doi 10.1371 / журнал. pone.0054171

    CAS Статья PubMed PubMed Central Google Scholar

  • Сюэ, Х., Чжун, М., Сюй, Дж. И Сюй, Л., Географическое расстояние влияет на распространение пятнисто распределенного большого длиннохвостого хомяка ( Tscherskia triton ), PLoS One, 2014, т.9, вып. 6, стр. e99540. doi 10.1371 / journal.pone.0099540

    Статья PubMed PubMed Central Google Scholar

  • Zhang, Y., Jin, S., Quan, G., Li, S., Ye, Z., Wang, F., и Zhang, M., Распространение видов млекопитающих в Китае , Пекин : Китайский лес. Publ. Дом, 1997.

    Google Scholar

  • Зубаков В.А., Глобальные климатические события Плейстоцена . Л .: Гидрометеоиздат, 1986.

    Google Scholar

  • уссурийский когтистый тритон, белигой-уссурийский тритон, когтистый тритон, onychodactylus fischeri, амфибия, хвостатая амфибия, дикая природа, серый фон, животное, животные россии, природа

    уссурийский когтистый тритон, белигой уссурийский тритон фисабиловый, клинтактильный тритон , хвостатая амфибия, дикая природа, серый фон, животное, животные россии, природа | Пикист уссури когтистый тритон, белигой уссурийский тритон, когтистый тритон, onychodactylus fischeri, амфибия, хвостатая амфибия, дикая природа, серый фон, животное, животные россии, природа

    Похожие фотографии

    • лиса, рыжая лиса, vulpes vulpes, рыжая лиса, лесное животное, дикое животное, мир животных, живая природа, хищник, млекопитающее, дикая природа Всеобщее достояние
    • косохвостый богомол, крестоносец, косохвостый, птица, лимоса, лаппоника, хвостатый, бар, вода, животное, пляж Всеобщее достояние
    • бабочка, ласточкин хвост бабочки, насекомое, природа, парусник, красочный, желтый, черный, ошибка, живая природа, чешуекрылые Всеобщее достояние
    • адлер, орлан-белохвост, белоголовый орлан, птица, раптор, природа, животное Всеобщее достояние
    • лягушка-бык, зеленый, пруд, лилии, лягушка, природа, амфибия, дикая природа, вода Всеобщее достояние
    • животные, птицы, природа, чайки, голуби, голуби, стена, берег реки, лондон, фон, размытый Всеобщее достояние
    • уссурийский когтистый тритон, белигой уссурийский тритон, когтистый тритон, onychodactylus fischeri, амфибия, хвостатая амфибия, дикая природа, серый фон, животное, природа, крупный план Всеобщее достояние
    • лягушка, земноводные, животное, животный мир, экзотические, тропические, красочные, природа, лист, завод, rotäugig Всеобщее достояние
    • сова, птица, передний диск, спит, клюв, пернатая, крупный план, животные, черный фон, хищный, животные россии Всеобщее достояние
    • Лебедь, водоплавающих птиц, птица, серый, вода, природа, белый, животное, перо, дикая природа Всеобщее достояние
    • лягушка, амфибия, дикая природа, зеленый, животное, лицо, рок, макро, тропический, экзотический, маленький Всеобщее достояние
    • геккон, рука, липкий, природа, рептилия, ящерица, зверек, амфибия, обои Всеобщее достояние
    • амфибия, черепаха, животное, броня, размытие, крупный план, исчезающие, природа, рептилия, панцирь, медленно Всеобщее достояние
    • лиса, животное, дикая природа, красный, макро, крупным планом, природа, на открытом воздухе Всеобщее достояние
    • белка, грызун, животное, пушистый, природа, за пределами, крупным планом, макрос, дикая природа, милый, красивый Всеобщее достояние
    • геккон, грубая ручка, централиан, ящерица, животное, австралия, рептилия, морда, лобная, грубая, центральная Всеобщее достояние
    • квакша, лягушка, природа, макро, зеленый, амфибия, животное Всеобщее достояние
    • лягушка, земноводный, животные, природа, встреча, hyla meridionalis, жаба, создание, когти, отдых, все гнилое дерево Всеобщее достояние
    • белохвост, олень, животное, природа, за пределами, сельская местность, дикая природа Всеобщее достояние
    • лягушка-бык, зеленый, пруд, кувшинок, лягушачий принц, корона, лягушка, природа, амфибия, лягушка-бык, дикая природа Всеобщее достояние
    • взрослый, повседневная, кавказская, очки, серый фон, счастье, счастливый, горизонтальный, радость, мужчина, мужчина Всеобщее достояние
    • кролик, заяц, животное, дикая природа, кролик, макро, крупным планом, природа Всеобщее достояние
    • орел, портрет, дикая, птица, природа, хищник, крупным планом, клюв, величие, орлан-белохвост, животное Всеобщее достояние
    • лягушка, амфибия, природа, макрос, на открытом воздухе, дикая природа, крупным планом, глаз, животное, вода, влажный Всеобщее достояние
    • Исландия, песец, лиса, животное, дикая природа, зима, снег, природа, холодная, млекопитающее Всеобщее достояние
    • волк, глаз, мех, дикий, животное, дикая природа, природа, хищник, млекопитающих, собак, серый Всеобщее достояние
    • море, черепаха, дайвинг, животное, океан, дикая природа, крупным планом, макро, оболочки, природа, на открытом воздухе Всеобщее достояние
    • горбатый кит, природное зрелище, природа, млекопитающее, животное, дикая природа, прыжки, колосс, водный, океан, вода Всеобщее достояние
    • животное, белка, поссьерлих, крупный план, круассан, изолированный, коготь, хвост, мех, внимание, любопытно Всеобщее достояние
    • дикая природа, олень, млекопитающее, молодые, животные, дикие, лес, природа Всеобщее достояние
    • лиса, рыжая лиса, vulpes vulpes, рыжая лиса, лесное животное, дикое животное, мир животных, живая природа, хищник, млекопитающее, дикая природа Всеобщее достояние
    • чернохвостый кролик, дикий, природа, дикая природа, портрет, сидит, уши, ищу, любопытный, пушистый, серый Всеобщее достояние
    • лягушка, макро, крупный план, портрет, детали, амфибия, изолированный, белый, фон, серая квакша, серая квакша Всеобщее достояние
    • волк, вой, животное, дикий, природа, дикая природа Всеобщее достояние
    • голубь, сизый голубь, птица, животное, Columbidae, дикая природа, сидя, серый, оперение, клюв, когти Всеобщее достояние
    • птица, сова, глаза, животное, глядя, природа, дикая природа, цифровое искусство Всеобщее достояние
    • млекопитающее, слон, дикая природа, животное, природа, дикие, африка, сафари, дикая местность, пейзаж, трава Всеобщее достояние
    • белохвостый олень, олененок, отдых, дикая природа, природа, молодой, на открытом воздухе, трава, луг, портрет, детка Всеобщее достояние
    • броненосец, оболочка, млекопитающее, дикая природа, животное, когти, милый, пластины, Техас, значок Всеобщее достояние
    • леопард, хищник, дикая кошка, животное, дикая природа, природа Всеобщее достояние
    • белка, рыжая белка, грызун, любопытный, животное, взгляд, взгляды, дикая природа, природа, нога, уши Всеобщее достояние
    • нарисованная черепаха, черепаха, макро, амфибия, природа, рептилии, водные, окружающая среда, биология, экология, животное Всеобщее достояние
    • животное, коричневый, существо, тварь, мех, пушистый, песчанка, стекло, волосатый, хомяк, мышь Всеобщее достояние
    • грызун, милый, млекопитающее, пуховые, животных, мало, белка, хвост, волосы, дикая природа, природа Всеобщее достояние
    • Лиса, млекопитающих, дикой природы, природы, животных, диких, мех, коричневый, пушистый, существо, глаза Всеобщее достояние
    • лиса, спать, отдых, расслабляющий, красный, животное, дикий, дикая природа, природа, млекопитающее, плотоядное животное Всеобщее достояние
    • животное, яблоко, существо, существо, еда, фрукты, песчанка, хомяк, мышь, домашнее животное, крыса Всеобщее достояние
    • Красная панда, животное, дикая природа, дикий, природа, млекопитающее, лес, жизнь, смешно, фауна, пушистый Всеобщее достояние
    • енот, животное, дикая природа, природа, на открытом воздухе, листья, макро, крупным планом Всеобщее достояние
    • лягушка, экзотика, крупный план, террариум, природа, синий, зоопарк, маленький, тропический, крошечный, существо Всеобщее достояние
    • Дикая кошка, животное, природа, кошка, природные, животные, уши, глаза, существо, зуб, укус Всеобщее достояние
    • животное, коричневый, существо, тварь, мех, пушистый, песчанка, стекло, волосатый, хомяк, мышь Всеобщее достояние
    • животное, яблоко, существо, существо, еда, фрукты, песчанка, хомяк, мышь, домашнее животное, крыса Всеобщее достояние
    • енот, дикое животное, пушистый, млекопитающее, природа, лесные животные, животные, wildpark poing, зоопарк, парк дикой природы Всеобщее достояние
    • цветы, фиолетовый, дерево, планка, свежий, природа, растение, фон, фон, серый, цвета Всеобщее достояние
    • животное, существо, мертвый, мех, пушистый, песчанка, волосы, волосатый, хомяк, мышь, вредитель Всеобщее достояние
    • медведь, бурый медведь, животные, природа, зоопарк, мир животных, парк дикой природы, мех, существо, млекопитающее, мужской Всеобщее достояние
    • олень, олененок, животное, природа, дикая природа, млекопитающее, молодые, дикие, на открытом воздухе, лес, ребенок Всеобщее достояние
    • бабочка, насекомое, макро, животное, природа, весна, сад, парк, крыло, цветок, природные Всеобщее достояние
    • лягушка, водяная лягушка, лягушачий пруд, земноводное, животное, сидит, кувшинок, пруд, вода, биотоп, природа Всеобщее достояние
    Загрузить еще .

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *